bpp-seq-omics-2.2.0/genIncludes.sh000775 001750 001750 00000001231 12372454303 020455 0ustar00jdutheiljdutheil000000 000000 #! /bin/bash createGeneric() { echo "-- Creating generic include file: $1.all" #Make sure we run into subdirectories first: dirs=() for file in "$1"/* do if [ -d "$file" ] then # Recursion: dirs+=( "$file" ) fi done for dir in ${dirs[@]} do createGeneric $dir done #Now list all files, including newly created .all files: if [ -f $1.all ] then rm $1.all fi dir=`basename $1` for file in "$1"/* do if [ -f "$file" ] && ( [ "${file##*.}" == "h" ] || [ "${file##*.}" == "all" ] ) then file=`basename $file` echo "#include \"$dir/$file\"" >> $1.all fi done; } createGeneric $1 bpp-seq-omics-2.2.0/src/CMakeLists.txt000664 001750 001750 00000007135 12407765466 021234 0ustar00jdutheiljdutheil000000 000000 # CMake script for Bio++ Sequence Library # Author: Sylvain Gaillard and Julien Dutheil # Created: 30/07/2012 # File list SET(CPP_FILES Bpp/Seq/Io/Fastq.cpp Bpp/Seq/Io/Maf/MafParser.cpp Bpp/Seq/Io/Maf/SequenceStreamToMafIterator.cpp Bpp/Seq/Io/Maf/MafIterator.cpp Bpp/Seq/Io/Maf/SequenceFilterMafIterator.cpp Bpp/Seq/Io/Maf/OrphanSequenceFilterMafIterator.cpp Bpp/Seq/Io/Maf/ChromosomeMafIterator.cpp Bpp/Seq/Io/Maf/DuplicateFilterMafIterator.cpp Bpp/Seq/Io/Maf/BlockMergerMafIterator.cpp Bpp/Seq/Io/Maf/ConcatenateMafIterator.cpp Bpp/Seq/Io/Maf/FullGapFilterMafIterator.cpp Bpp/Seq/Io/Maf/AlignmentFilterMafIterator.cpp Bpp/Seq/Io/Maf/EntropyFilterMafIterator.cpp Bpp/Seq/Io/Maf/MaskFilterMafIterator.cpp Bpp/Seq/Io/Maf/QualityFilterMafIterator.cpp Bpp/Seq/Io/Maf/FeatureFilterMafIterator.cpp Bpp/Seq/Io/Maf/FeatureExtractorMafIterator.cpp Bpp/Seq/Io/Maf/OutputMafIterator.cpp Bpp/Seq/Io/Maf/OutputAlignmentMafIterator.cpp Bpp/Seq/Io/Maf/VcfOutputMafIterator.cpp Bpp/Seq/Io/Maf/CoordinatesOutputMafIterator.cpp Bpp/Seq/Io/Maf/SequenceStatisticsMafIterator.cpp Bpp/Seq/Io/Maf/WindowSplitMafIterator.cpp Bpp/Seq/Io/Maf/MafSequence.cpp Bpp/Seq/Io/Maf/MafStatistics.cpp Bpp/Seq/Io/Maf/IterationListener.cpp Bpp/Seq/Feature/SequenceFeature.cpp Bpp/Seq/Feature/SequenceFeatureTools.cpp Bpp/Seq/Feature/Gff/GffFeatureReader.cpp Bpp/Seq/Feature/Gtf/GtfFeatureReader.cpp ) SET(H_FILES Bpp/Seq/Io/Fastq.h Bpp/Seq/Io/Maf/MafSequence.h Bpp/Seq/Io/Maf/MafParser.h Bpp/Seq/Io/Maf/SequenceStreamToMafIterator.h Bpp/Seq/Io/Maf/MafIterator.h Bpp/Seq/Io/Maf/BlockLengthMafIterator.h Bpp/Seq/Io/Maf/BlockSizeMafIterator.h Bpp/Seq/Io/Maf/SequenceFilterMafIterator.h Bpp/Seq/Io/Maf/OrphanSequenceFilterMafIterator.h Bpp/Seq/Io/Maf/ChromosomeMafIterator.h Bpp/Seq/Io/Maf/DuplicateFilterMafIterator.h Bpp/Seq/Io/Maf/BlockMergerMafIterator.h Bpp/Seq/Io/Maf/ConcatenateMafIterator.h Bpp/Seq/Io/Maf/FullGapFilterMafIterator.h Bpp/Seq/Io/Maf/AlignmentFilterMafIterator.h Bpp/Seq/Io/Maf/EntropyFilterMafIterator.h Bpp/Seq/Io/Maf/MaskFilterMafIterator.h Bpp/Seq/Io/Maf/QualityFilterMafIterator.h Bpp/Seq/Io/Maf/FeatureFilterMafIterator.h Bpp/Seq/Io/Maf/FeatureExtractorMafIterator.h Bpp/Seq/Io/Maf/OutputMafIterator.h Bpp/Seq/Io/Maf/OutputAlignmentMafIterator.h Bpp/Seq/Io/Maf/VcfOutputMafIterator.h Bpp/Seq/Io/Maf/CoordinatesOutputMafIterator.h Bpp/Seq/Io/Maf/SequenceStatisticsMafIterator.h Bpp/Seq/Io/Maf/WindowSplitMafIterator.h Bpp/Seq/Io/Maf/MafStatistics.h Bpp/Seq/Io/Maf/IterationListener.h Bpp/Seq/Feature/SequenceFeature.h Bpp/Seq/Feature/SequenceFeatureTools.h Bpp/Seq/Feature/FeatureReader.h Bpp/Seq/Feature/Gff/GffFeatureReader.h Bpp/Seq/Feature/Gtf/GtfFeatureReader.h ) # Build the static lib ADD_LIBRARY(bppseqomics-static STATIC ${CPP_FILES}) SET_TARGET_PROPERTIES(bppseqomics-static PROPERTIES OUTPUT_NAME bpp-seq-omics CLEAN_DIRECT_OUTPUT 1 ) TARGET_LINK_LIBRARIES(bppseqomics-static ${LIBS}) # Build the shared lib ADD_LIBRARY(bppseqomics-shared SHARED ${CPP_FILES}) SET_TARGET_PROPERTIES(bppseqomics-shared PROPERTIES OUTPUT_NAME bpp-seq-omics CLEAN_DIRECT_OUTPUT 1 VERSION ${BPPSEQOMICS_VERSION} SOVERSION ${BPPSEQOMICS_VERSION_MAJOR} ) TARGET_LINK_LIBRARIES(bppseqomics-shared ${LIBS}) # Install libs INSTALL(TARGETS bppseqomics-static bppseqomics-shared DESTINATION lib${LIB_SUFFIX}) # Install headers INSTALL(DIRECTORY Bpp/ DESTINATION include/Bpp FILES_MATCHING PATTERN "*.h") # Generate generic include files (.all) INSTALL(CODE "EXECUTE_PROCESS(COMMAND ${CMAKE_SOURCE_DIR}/genIncludes.sh ${CMAKE_PREFIX_PATH}/include/Bpp)") bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/FeatureExtractorMafIterator.cpp000664 001750 001750 00000011652 12407765466 027147 0ustar00jdutheiljdutheil000000 000000 // // File: FeatureExtractorMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "FeatureExtractorMafIterator.h" //From bpp-seq: #include using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* FeatureExtractor::analyseCurrentBlock_() throw (Exception) { while (blockBuffer_.size() == 0) { //Unless there is no more block in the buffer, we need to parse more: auto_ptr block; START: block.reset(iterator_->nextBlock()); if (!block.get()) return 0; //No more block. //Check if the block contains the reference species: if (!block->hasSequenceForSpecies(refSpecies_)) goto START; //Get the feature ranges for this block: const MafSequence& refSeq = block->getSequenceForSpecies(refSpecies_); //first check if there is one (for now we assume that features refer to the chromosome or contig name, with implicit species): std::map >::iterator mr = ranges_.find(refSeq.getChromosome()); if (mr == ranges_.end()) goto START; RangeSet ranges = mr->second; if (completeOnly_) ranges.filterWithin(refSeq.getRange(true)); else ranges.restrictTo(refSeq.getRange(true)); if (ranges.isEmpty()) goto START; //If the reference sequence is on the negative strand, then we have to correct the coordinates: if (refSeq.getStrand() == '-') { RangeSet cRanges; for (set*>::iterator it = ranges.getSet().begin(); it != ranges.getSet().end(); ++it) { cRanges.addRange(Range(refSeq.getSrcSize() - (**it).end(), refSeq.getSrcSize() - (**it).begin())); } ranges = cRanges; } //We will need to convert to alignment positions, using a sequence walker: SequenceWalker walker(refSeq); //Now creates all blocks for all ranges: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Extracting annotations", true); } if (logstream_) { (*logstream_ << "FEATURE EXTRACTOR: extracting " << ranges.getSet().size() << " features from block " << block->getDescription() << ".").endLine(); } size_t i = 0; for (set*>::iterator it = ranges.getSet().begin(); it != ranges.getSet().end(); ++it) { if (verbose_) { ApplicationTools::displayGauge(i++, ranges.getSet().size() - 1, '='); } MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { auto_ptr subseq; size_t a = walker.getAlignmentPosition((**it).begin() - refSeq.start()); size_t b = walker.getAlignmentPosition((**it).end() - refSeq.start() - 1); subseq.reset(block->getSequence(j).subSequence(a, b - a + 1)); if (!ignoreStrand_) { if (dynamic_cast(*it)->isNegativeStrand()) { SequenceTools::invertComplement(*subseq); } } newBlock->addSequence(*subseq); } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); } MafBlock* nxtBlock = blockBuffer_.front(); blockBuffer_.pop_front(); return nxtBlock; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/SequenceStatisticsMafIterator.h000664 001750 001750 00000007552 12407765466 027154 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceStatisticsMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _SEQUENCESTATISTICSMAFITERATOR_H_ #define _SEQUENCESTATISTICSMAFITERATOR_H_ #include "MafIterator.h" #include "MafStatistics.h" //From the STL: #include #include #include namespace bpp { /** * @brief Compute a series of sequence statistics for each block. * * Computed statistics are stored into a vector of double, which can be retrieved as well as statistics names. * Listeners can be set up to automatically analyse or write the output after iterations are over. * * The current implementation focuses on speed and memory efificiency, as it only stores in memory the current results of the statistics. * The only drawback of this, is that disk access might be high when writing the results, * although appropriate buffering should most likely circumvent the issue. * The code is easily extensible, however, to enable storage of all results into a matrix, * with writing only once at the end of iterations. */ class SequenceStatisticsMafIterator: public AbstractFilterMafIterator { private: std::vector statistics_; std::vector results_; std::vector names_; public: /** * @param iterator The input iterator. * @param statistics A vector of pointers toward MafStatistics, to be computed simultaneously for each maf block. */ SequenceStatisticsMafIterator(MafIterator* iterator, const std::vector statistics); private: SequenceStatisticsMafIterator(const SequenceStatisticsMafIterator& iterator) : AbstractFilterMafIterator(0), statistics_(iterator.statistics_), results_(iterator.results_), names_(iterator.names_) {} SequenceStatisticsMafIterator& operator=(const SequenceStatisticsMafIterator& iterator) { statistics_ = iterator.statistics_; results_ = iterator.results_; names_ = iterator.names_; return *this; } public: const std::vector& getResults() const { return results_; } const std::vector& getResultsColumnNames() const { return names_; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_SEQUENCESTATISTICSMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/WindowSplitMafIterator.cpp000664 001750 001750 00000007162 12372454303 026126 0ustar00jdutheiljdutheil000000 000000 // // File: WindowSplitMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "WindowSplitMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; const short WindowSplitMafIterator::RAGGED_LEFT = 0; const short WindowSplitMafIterator::RAGGED_RIGHT = 1; const short WindowSplitMafIterator::CENTER = 2; const short WindowSplitMafIterator::ADJUST= 3; MafBlock* WindowSplitMafIterator::analyseCurrentBlock_() throw (Exception) { while (blockBuffer_.size() == 0) { //Build a new series of windows: MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. size_t pos = 0; size_t size = windowSize_; size_t bSize = block->getNumberOfSites(); switch (align_) { case (RAGGED_RIGHT) : { pos = bSize % windowSize_; break; } case (CENTER) : { pos = (bSize % windowSize_) / 2; break; } case (ADJUST) : { size_t x = bSize / windowSize_; if (x == 0) size = bSize; else size = bSize / x; break; } default : { } } //cout << "Effective size: " << size << endl; for(size_t i = pos; i + size < bSize; i += size) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); if (align_ == ADJUST) { if (bSize - (i + size) > 0 && bSize - (i + size) < size) { //cout << "Old size: " << size; size = bSize - i; //Adjust for last block because of rounding. //this should not increase size by more than 1! //cout << " => new size: " << size << endl; } } for (unsigned int j = 0; j < block->getNumberOfSequences(); ++j) { auto_ptr subseq(block->getSequence(j).subSequence(i, size)); newBlock->addSequence(*subseq); } blockBuffer_.push_back(newBlock); } delete block; } MafBlock* nxtBlock = blockBuffer_.front(); blockBuffer_.pop_front(); return nxtBlock; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/IterationListener.cpp000664 001750 001750 00000005440 12407765466 025164 0ustar00jdutheiljdutheil000000 000000 // // File: IterationListener.cpp // Authors: Julien Dutheil // Created: Wed Jun 27 2012 // /* Copyright or © or Copr. Bio++ Development Team, (2012) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "IterationListener.h" // From the STL: #include using namespace std; using namespace bpp; void CsvStatisticsOutputIterationListener::iterationStarts() { const vector& header = statsIterator_->getResultsColumnNames(); *output_ << "Chr" << sep_ << "Start" << sep_ << "Stop"; for (size_t i = 0; i < header.size(); ++i) { *output_ << sep_ << header[i]; } output_->endLine(); } void CsvStatisticsOutputIterationListener::iterationMoves(const MafBlock& currentBlock) { const vector& values = statsIterator_->getResults(); if (currentBlock.hasSequenceForSpecies(refSpecies_)) { const MafSequence& refSeq = currentBlock.getSequenceForSpecies(refSpecies_); if (refSeq.hasCoordinates()) *output_ << refSeq.getChromosome() << sep_ << refSeq.start() << sep_ << refSeq.stop(); else *output_ << "NA" << sep_ << "NA" << sep_ << "NA"; } else { *output_ << "NA" << sep_ << "NA" << sep_ << "NA"; } for (size_t i = 0; i < values.size(); ++i) { *output_ << sep_ << (values[i] ? values[i]->toString() : "NA"); //Memory cleaning: if (values[i]) delete values[i]; } output_->endLine(); } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafStatistics.cpp000664 001750 001750 00000035760 12407765466 024306 0ustar00jdutheiljdutheil000000 000000 // // File: MafStatistics.cpp // Authors: Julien Dutheil // Created: Mon Jun 25 2012 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "MafStatistics.h" #include #include #include //From bpp-core: #include //From the STL: #include #include using namespace bpp; using namespace std; void PairwiseDivergenceMafStatistics::compute(const MafBlock& block) { vector seqs1 = block.getSequencesForSpecies(species1_); vector seqs2 = block.getSequencesForSpecies(species2_); if (seqs1.size() > 1 || seqs2.size() > 1) throw Exception("PairwiseDivergenceMafStatistics::compute. Duplicated sequence for species " + species1_ + "or " + species2_ + "."); if (seqs1.size() == 0 || seqs2.size() == 0) result_.setValue(NumConstants::NaN()); else result_.setValue(100. - SequenceTools::getPercentIdentity(*seqs1[0], *seqs2[0], true)); } vector CharacterCountsMafStatistics::getSupportedTags() const { vector tags; for (int i = 0; i < static_cast(alphabet_->getSize()); ++i) { tags.push_back(alphabet_->intToChar(i)); } tags.push_back("Gap"); tags.push_back("Unresolved"); return tags; } void CharacterCountsMafStatistics::compute(const MafBlock& block) { std::map counts; SequenceContainerTools::getCounts(block.getAlignment(), counts); for (int i = 0; i < static_cast(alphabet_->getSize()); ++i) { result_.setValue(alphabet_->intToChar(i), counts[i]); } result_.setValue("Gap", counts[alphabet_->getGapCharacterCode()]); double countUnres = 0; for (map::iterator it = counts.begin(); it != counts.end(); ++it) { if (alphabet_->isUnresolved(it->first)) countUnres += it->second; } result_.setValue("Unresolved", countUnres); } SiteContainer* AbstractSpeciesSelectionMafStatistics::getSiteContainer_(const MafBlock& block) { VectorSiteContainer* alignment = new VectorSiteContainer(block.getAlignment().getAlphabet()); for (size_t i = 0; i < species_.size(); ++i) { if (block.hasSequenceForSpecies(species_[i])) { vector selection = block.getSequencesForSpecies(species_[i]); for (size_t j = 0; j < selection.size(); ++j) { alignment->addSequence(*selection[j]); } } } return alignment; } AbstractSpeciesMultipleSelectionMafStatistics::AbstractSpeciesMultipleSelectionMafStatistics(const std::vector< std::vector >& species): species_(species) { size_t n = VectorTools::vectorUnion(species).size(); size_t m = 0; for (size_t i = 0; i < species.size(); ++i) m += species_[i].size(); if (m != n) throw Exception("AbstractSpeciesMultipleSelectionMafStatistics (constructor). Species selections must be fully distinct."); } vector AbstractSpeciesMultipleSelectionMafStatistics::getSiteContainers_(const MafBlock& block) { vector alignments; for (size_t k = 0; k < species_.size(); ++k) { VectorSiteContainer* alignment = new VectorSiteContainer(block.getAlignment().getAlphabet()); for (size_t i = 0; i < species_[k].size(); ++i) { if (block.hasSequenceForSpecies(species_[k][i])) { vector selection = block.getSequencesForSpecies(species_[k][i]); for (size_t j = 0; j < selection.size(); ++j) { alignment->addSequence(*selection[j]); } } } alignments.push_back(alignment); } return alignments; } vector SiteFrequencySpectrumMafStatistics::getSupportedTags() const { vector tags; for (size_t i = 0; i < categorizer_.getNumberOfCategories(); ++i) { tags.push_back("Bin" + TextTools::toString(i + 1)); } tags.push_back("Unresolved"); tags.push_back("Saturated"); tags.push_back("Ignored"); return tags; } void SiteFrequencySpectrumMafStatistics::compute(const MafBlock& block) { unsigned int nbUnresolved = 0; unsigned int nbSaturated = 0; unsigned int nbIgnored = 0; counts_.assign(categorizer_.getNumberOfCategories(), 0); int state; bool hasOutgroup = (outgroup_ != ""); bool isAnalyzable; auto_ptr alignment; const Sequence* outgroupSeq = 0; if (hasOutgroup) { isAnalyzable = (block.hasSequenceForSpecies(outgroup_) && block.getNumberOfSequences() > 1); if (isAnalyzable) { //We need to extract the outgroup sequence: outgroupSeq = &block.getSequenceForSpecies(outgroup_); //Here we assume there is only one! Otherwise we take the first one... alignment.reset(getSiteContainer_(block)); } } else { isAnalyzable = (block.getNumberOfSequences() > 0); if (isAnalyzable) alignment.reset(getSiteContainer_(block)); } if (isAnalyzable) { for (size_t i = 0; i < alignment->getNumberOfSites(); ++i) { //Note: we do not rely on SiteTool::getCounts as it would be unefficient to count everything. const Site& site = alignment->getSite(i); map counts; bool isUnresolved = false; bool isSaturated = false; for (size_t j = 0; !isUnresolved && !isSaturated && j < site.size(); ++j) { state = site[j]; if (alphabet_->isGap(state) || alphabet_->isUnresolved(state)) { isUnresolved = true; } else { counts[state]++; if (counts.size() > 2) { isSaturated = true; } } } if (isUnresolved) { nbUnresolved++; } else if (isSaturated) { nbSaturated++; } else if (hasOutgroup && ( alignment->getAlphabet()->isGap((*outgroupSeq)[i]) || alignment->getAlphabet()->isUnresolved((*outgroupSeq)[i]))) { nbUnresolved++; } else { //Determine frequency class: double count; if (counts.size() == 1) { if (hasOutgroup) { if (counts.begin()->first == (*outgroupSeq)[i]) count = 0; //This is the ancestral state. else count = counts.begin()->second; //This is a derived state. } else { count = 0; //In this case we do not know, so we put 0. } } else { map::iterator it = counts.begin(); unsigned int count1 = it->second; it++; unsigned int count2 = it->second; if (hasOutgroup) { if (counts.begin()->first == (*outgroupSeq)[i]) count = counts.rbegin()->second; //This is the ancestral state, therefore we other one is the derived state. else if (counts.rbegin()->first == (*outgroupSeq)[i]) count = counts.begin()->second; //The second state is the ancestral one, therefore the first one is the derived state. else { //None of the two states are ancestral! The position is therefore discarded. isSaturated = true; } } else { count = min(count1, count2); //In this case we do not know, so we take the minimum of the two values. } } if (isSaturated) nbSaturated++; else { try { counts_[categorizer_.getCategory(count) - 1]++; } catch (OutOfRangeException& oof) { nbIgnored++; } } } } } result_.setValue("Unresolved", nbUnresolved); result_.setValue("Saturated", nbSaturated); result_.setValue("Ignored", nbIgnored); for (size_t i = 0; i < counts_.size(); ++i) { result_.setValue("Bin" + TextTools::toString(i + 1), counts_[i]); } } vector FourSpeciesPatternCountsMafStatistics::getSupportedTags() const { vector tags; tags.push_back("f1100"); tags.push_back("f0110"); tags.push_back("f1010"); tags.push_back("Ignored"); return tags; } void FourSpeciesPatternCountsMafStatistics::compute(const MafBlock& block) { counts_.assign(6, 0); auto_ptr alignment(getSiteContainer_(block)); if (alignment->getNumberOfSequences() == 4) { unsigned int nbIgnored = 0; for (size_t i = 0; i < block.getNumberOfSites(); ++i) { const Site& site = alignment->getSite(i); if (SiteTools::isComplete(site)) { if (site[0] == site[1] && site[2] != site[1] && site[3] == site[2]) counts_[0]++; else if (site[1] == site[2] && site[1] != site[0] && site[3] == site[0]) counts_[1]++; else if (site[0] == site[2] && site[1] != site[0] && site[3] == site[1]) counts_[2]++; } else { nbIgnored++; } } result_.setValue("f1100", counts_[0]); result_.setValue("f0110", counts_[1]); result_.setValue("f1010", counts_[2]); result_.setValue("Ignored", nbIgnored); } else { result_.setValue("f1100", 0); result_.setValue("f0110", 0); result_.setValue("f1010", 0); result_.setValue("Ignored", static_cast(block.getNumberOfSites())); } } vector SiteMafStatistics::getSupportedTags() const { vector tags; tags.push_back("NbWithoutGap"); tags.push_back("NbComplete"); tags.push_back("NbParsimonyInformative"); return tags; } void SiteMafStatistics::compute(const MafBlock& block) { auto_ptr alignment(getSiteContainer_(block)); unsigned int nbNg = 0; unsigned int nbCo = 0; unsigned int nbPi = 0; if (alignment->getNumberOfSequences() > 0) { for (size_t i = 0; i < alignment->getNumberOfSites(); ++i) { if (!SiteTools::hasGap(alignment->getSite(i))) nbNg++; if (SiteTools::isComplete(alignment->getSite(i))) nbCo++; if (SiteTools::isParsimonyInformativeSite(alignment->getSite(i))) nbPi++; } } result_.setValue("NbWithoutGap", nbNg); result_.setValue("NbComplete", nbCo); result_.setValue("NbParsimonyInformative", nbPi); } vector PolymorphismMafStatistics::getSupportedTags() const { vector tags; tags.push_back("F"); tags.push_back("P"); tags.push_back("FP"); tags.push_back("PF"); tags.push_back("FF"); tags.push_back("X"); tags.push_back("FX"); tags.push_back("PX"); tags.push_back("XF"); tags.push_back("XP"); return tags; } vector PolymorphismMafStatistics::getPatterns_(const SiteContainer& sites) { vector patterns(sites.getNumberOfSites()); for (size_t i = 0; i < sites.getNumberOfSites(); ++i) { const Site& site = sites.getSite(i); int s = -1; //Unresolved if (SiteTools::isComplete(site)) { if (SiteTools::isConstant(site)) { s = site[0]; //The fixed state } else { s = -10; //Polymorphic. } } patterns[i] = s; } return patterns; } void PolymorphismMafStatistics::compute(const MafBlock& block) { vector alignments(getSiteContainers_(block)); unsigned int nbF = 0; unsigned int nbP = 0; unsigned int nbFF = 0; unsigned int nbFP = 0; unsigned int nbPF = 0; unsigned int nbX = 0; unsigned int nbFX = 0; unsigned int nbPX = 0; unsigned int nbXF = 0; unsigned int nbXP = 0; //Get all patterns: vector patterns1(block.getNumberOfSites(), -1); vector patterns2(block.getNumberOfSites(), -1); if (alignments[0]->getNumberOfSequences() > 0) { patterns1 = getPatterns_(*alignments[0]); } if (alignments[1]->getNumberOfSequences() > 0) { patterns2 = getPatterns_(*alignments[1]); } //Compare patterns: for (size_t i = 0; i < block.getNumberOfSites(); ++i) { int p1 = patterns1[i]; int p2 = patterns2[i]; switch (p1) { case -1 : switch (p2) { case -1 : nbX++; break; case -10 : nbXP++; break; default : nbXF++; } break; case -10 : switch (p2) { case -1 : nbPX++; break; case -10 : nbP++; break; default : nbPF++; } break; default : switch (p2) { case -1 : nbFX++; break; case -10 : nbFP++; break; default : if (p1 == p2) nbF++; else nbFF++; } } } //Set results: result_.setValue("F", nbF); result_.setValue("P", nbP); result_.setValue("FF", nbFF); result_.setValue("FP", nbFP); result_.setValue("PF", nbPF); result_.setValue("X", nbX); result_.setValue("FX", nbFX); result_.setValue("PX", nbPX); result_.setValue("XF", nbXF); result_.setValue("XP", nbXP); } vector SequenceDiversityMafStatistics::getSupportedTags() const { vector tags; tags.push_back("NbSeggregating"); tags.push_back("WattersonTheta"); return tags; } void SequenceDiversityMafStatistics::compute(const MafBlock& block) { auto_ptr alignment(getSiteContainer_(block)); unsigned int nbSeg = 0; unsigned int nbTot = 0; if (alignment->getNumberOfSequences() > 0) { for (size_t i = 0; i < alignment->getNumberOfSites(); ++i) { const Site& site = alignment->getSite(i); if (SiteTools::isComplete(site)) { nbTot++; if (!SiteTools::isConstant(site)) nbSeg++; } } } double wt = 0; if (nbSeg > 0) { size_t n = alignment->getNumberOfSequences(); double hf = 0; for (double i = 1; i < n; ++i) hf += 1. / i; wt = static_cast(nbSeg) / (static_cast(nbTot) * hf); } result_.setValue("NbSeggregating", nbSeg); result_.setValue("WattersonTheta", wt); } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafSequence.cpp000664 001750 001750 00000004545 12372454303 023703 0ustar00jdutheiljdutheil000000 000000 // // File: MafSequence.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "MafSequence.h" //From the STL: #include using namespace bpp; using namespace std; MafSequence* MafSequence::subSequence(size_t startAt, size_t length) const { string subseq = toString().substr(startAt, length); size_t begin = begin_; if (hasCoordinates_) { for (unsigned int i = 0; i < startAt; ++i) { if (! getAlphabet()->isGap(operator[](i))) begin++; } } MafSequence* newSeq = new MafSequence(getName(), subseq, begin, strand_, srcSize_); if (!hasCoordinates_) newSeq->removeCoordinates(); vector anno = getAnnotationTypes(); for (size_t i = 0; i < anno.size(); ++i) { newSeq->addAnnotation(getAnnotation(anno[i]).getPartAnnotation(startAt, length)); } return newSeq; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/BlockMergerMafIterator.h000664 001750 001750 00000007766 12372454303 025516 0ustar00jdutheiljdutheil000000 000000 // // File: BlockMergerMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _BLOCKMERGERMAFITERATOR_H_ #define _BLOCKMERGERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Merge blocks if some of their sequences are contiguous. * * The user specifies the focus species. Sequences that are not in this set will * be automatically merged and their coordinates removed. * The scores, if any, will be averaged for the block, weighted by the corresponding block sizes. * The pass value will be removed if it is different for the two blocks. * It is possible to define a maximum distance for the merging. Setting a distance of zero implies that the blocks * have to be exactly contiguous. Alternatively, the appropriate number of 'N' will be inserted in all species. * All species however have to be distant of the exact same amount. */ class BlockMergerMafIterator: public AbstractFilterMafIterator { private: std::vector species_; MafBlock* incomingBlock_; std::vector ignoreChrs_; //These chromsomes will never be merged (ex: 'Un'). unsigned int maxDist_; public: BlockMergerMafIterator(MafIterator* iterator, const std::vector& species, unsigned int maxDist = 0) : AbstractFilterMafIterator(iterator), species_(species), incomingBlock_(0), ignoreChrs_(), maxDist_(maxDist) { incomingBlock_ = iterator->nextBlock(); } private: BlockMergerMafIterator(const BlockMergerMafIterator& iterator) : AbstractFilterMafIterator(0), species_(iterator.species_), incomingBlock_(iterator.incomingBlock_), ignoreChrs_(iterator.ignoreChrs_), maxDist_(iterator.maxDist_) {} BlockMergerMafIterator& operator=(const BlockMergerMafIterator& iterator) { species_ = iterator.species_; incomingBlock_ = iterator.incomingBlock_; ignoreChrs_ = iterator.ignoreChrs_; maxDist_ = iterator.maxDist_; return *this; } public: /** * brief Add a chromosome that should be ignored to the list. * @param chr The name of the chromosome to be ignored. */ void ignoreChromosome(const std::string& chr) { ignoreChrs_.push_back(chr); } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_BLOCKMERGERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/QualityFilterMafIterator.cpp000664 001750 001750 00000021675 12372454303 026446 0ustar00jdutheiljdutheil000000 000000 // // File: QualityFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "QualityFilterMafIterator.h" //From bpp-seq: #include using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* QualityFilterMafIterator::analyseCurrentBlock_() throw (Exception) { if (blockBuffer_.size() == 0) { do { //Else there is no more block in the buffer, we need parse more: MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. //Parse block. vector< vector > aln; for (size_t i = 0; i < species_.size(); ++i) { const MafSequence* seq = &block->getSequenceForSpecies(species_[i]); if (seq->hasAnnotation(SequenceQuality::QUALITY_SCORE)) { aln.push_back(dynamic_cast(seq->getAnnotation(SequenceQuality::QUALITY_SCORE)).getScores()); } } if (aln.size() != species_.size()) { blockBuffer_.push_back(block); if (logstream_) { (*logstream_ << "QUAL CLEANER: block is missing quality score for at least one species and will therefore not be filtered.").endLine(); } //NB here we could decide to discard the block instead! } else { size_t nr = aln.size(); size_t nc = block->getNumberOfSites(); //First we create a mask: vector pos; vector col(nr); //Reset window: window_.clear(); //Init window: size_t i; for (i = 0; i < windowSize_; ++i) { for (size_t j = 0; j < nr; ++j) { col[j] = aln[j][i]; } window_.push_back(col); } //Slide window: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Sliding window for quality filter", true); } while (i + step_ < nc) { if (verbose_) ApplicationTools::displayGauge(i - windowSize_, nc - windowSize_ - 1, '>'); //Evaluate current window: double mean = 0; double n = static_cast(aln.size() * windowSize_); for (size_t u = 0; u < window_.size(); ++u) for (size_t v = 0; v < window_[u].size(); ++v) { mean += (window_[u][v] > 0 ? static_cast(window_[u][v]) : 0.); if (window_[u][v] == -1) n--; } if (n > 0 && (mean / n) < minQual_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ <= pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } //Move forward: for (size_t k = 0; k < step_; ++k) { for (size_t j = 0; j < nr; ++j) { col[j] = aln[j][i]; } window_.push_back(col); window_.pop_front(); ++i; } } //Evaluate last window: double mean = 0; double n = static_cast(aln.size() * windowSize_); for (size_t u = 0; u < window_.size(); ++u) for (size_t v = 0; v < window_[u].size(); ++v) { mean += (window_[u][v] > 0 ? static_cast(window_[u][v]) : 0.); if (window_[u][v] == -1) n--; } if (n > 0 && (mean / n) < minQual_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ < pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } if (verbose_) ApplicationTools::displayTaskDone(); //Now we remove regions with two many gaps, using a sliding window: if (pos.size() == 0) { blockBuffer_.push_back(block); if (logstream_) { (*logstream_ << "QUAL CLEANER: block is clean and kept as is.").endLine(); } } else if (pos.size() == 2 && pos.front() == 0 && pos.back() == block->getNumberOfSites()) { //Everything is removed: if (logstream_) { (*logstream_ << "QUAL CLEANER: block was entirely removed. Tried to get the next one.").endLine(); } } else { if (logstream_) { (*logstream_ << "QUAL CLEANER: block with size "<< block->getNumberOfSites() << " will be split into " << (pos.size() / 2 + 1) << " blocks.").endLine(); } if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Spliting block", true); } for (i = 0; i < pos.size(); i+=2) { if (verbose_) ApplicationTools::displayGauge(i, pos.size() - 2, '='); if (logstream_) { (*logstream_ << "QUAL CLEANER: removing region (" << pos[i] << ", " << pos[i+1] << ") from block.").endLine(); } if (pos[i] > 0) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; if (i == 0) { subseq = block->getSequence(j).subSequence(0, pos[i]); } else { subseq = block->getSequence(j).subSequence(pos[i - 1], pos[i] - pos[i - 1]); } newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (keepTrashedBlocks_) { MafBlock* outBlock = new MafBlock(); outBlock->setScore(block->getScore()); outBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* outseq = block->getSequence(j).subSequence(pos[i], pos[i + 1] - pos[i]); outBlock->addSequence(*outseq); delete outseq; } trashBuffer_.push_back(outBlock); } } //Add last block: if (pos[pos.size() - 1] < block->getNumberOfSites()) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; subseq = block->getSequence(j).subSequence(pos[pos.size() - 1], block->getNumberOfSites() - pos[pos.size() - 1]); newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); delete block; } } } while (blockBuffer_.size() == 0); } MafBlock* block = blockBuffer_.front(); blockBuffer_.pop_front(); return block; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/WindowSplitMafIterator.h000664 001750 001750 00000005450 12407765466 025607 0ustar00jdutheiljdutheil000000 000000 // // File: WindowSplitMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _WINDOWSPLITMAFITERATOR_H_ #define _WINDOWSPLITMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Splits block into windows of given sizes. */ class WindowSplitMafIterator: public AbstractFilterMafIterator { private: unsigned int windowSize_; short align_; std::deque blockBuffer_; public: static const short RAGGED_LEFT; static const short RAGGED_RIGHT; static const short CENTER; static const short ADJUST; public: WindowSplitMafIterator(MafIterator* iterator, unsigned int windowSize, short splitOption = CENTER) throw (Exception): AbstractFilterMafIterator(iterator), windowSize_(windowSize), align_(splitOption), blockBuffer_() { if (splitOption != RAGGED_LEFT && splitOption != RAGGED_RIGHT && splitOption != CENTER && splitOption != ADJUST) throw Exception("WindowSplitMafIterator: unvalid split option: " + TextTools::toString(splitOption)); } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_WINDOWSPLITMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/VcfOutputMafIterator.cpp000664 001750 001750 00000012644 12407765466 025621 0ustar00jdutheiljdutheil000000 000000 // // File: VcfOutputMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Jan 05 2013 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "VcfOutputMafIterator.h" //From bpp-seq: #include #include #include #include #include using namespace bpp; //From the STL: #include #include #include using namespace std; void VcfOutputMafIterator::writeHeader_(std::ostream& out) const { time_t t = time(0); // get current time struct tm* ct = localtime(&t); out << "##fileformat=VCFv4.0" << endl; out << "##fileDate=" << (ct->tm_year + 1900) << (ct->tm_mon + 1) << ct->tm_mday << endl; out << "##source=Bio++" << endl; out << "##FILTER=" << endl; out << "##FILTER=" << endl; if (genotypes_.size() > 0) out << "##FORMAT=" << endl; //There are more options in the header that we may want to support... //Now write the header line: out << "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO"; if (genotypes_.size() > 0) { out << "\tFORMAT"; for (size_t i = 0; i < genotypes_.size(); ++i) out << "\t" << genotypes_[i]; } out << endl; } void VcfOutputMafIterator::writeBlock_(std::ostream& out, const MafBlock& block) const { const MafSequence& refSeq = block.getSequenceForSpecies(refSpecies_); string chr = refSeq.getChromosome(); SequenceWalker walker(refSeq); size_t offset = refSeq.start(); int gap = refSeq.getAlphabet()->getGapCharacterCode(); map chars; for (int i = 0; i < static_cast(AlphabetTools::DNA_ALPHABET.getNumberOfTypes()); ++i) chars[i] = AlphabetTools::DNA_ALPHABET.intToChar(i); VectorSiteContainer sites(block.getAlignment()); //Where to store genotype information, if any: vector gt(genotypes_.size()); //Now we look all sites for SNPs: for (size_t i = 0; i < sites.getNumberOfSites(); i++) { if (refSeq[i] == gap) continue; string filter = ""; if (SiteTools::hasGap(sites.getSite(i))) { filter = "gap"; } if (SiteTools::hasUnknown(sites.getSite(i))) { if (filter != "") filter += ","; filter += "unk"; } if (filter == "") filter = "PASS"; map counts; SiteTools::getCounts(sites.getSite(i), counts); int ref = refSeq[i]; string alt = ""; string ac = ""; map snps; int c = 0; for (int x = 0; x < 4; ++x) { if (x != ref) { size_t f = counts[x]; if (f > 0) { if (alt != "") { alt += ","; ac += ","; } alt += chars[x]; ac += TextTools::toString(f); snps[x] = ++c; } } else { snps[x] = 0; } } if (ac != "") { out << chr << "\t" << (offset + walker.getSequencePosition(i) + 1) << "\t.\t" << chars[refSeq[i]] << "\t" << alt << "\t.\t" << filter << "\tAC=" << ac; //Write genotpyes: if (genotypes_.size() > 0) { out << "\tGT"; for (size_t g = 0; g < genotypes_.size(); ++g) { vector sequences = block.getSequencesForSpecies(genotypes_[g]); if (sequences.size() == 0) out << "\t."; else if (sequences.size() > 1) throw Exception("VcfOutputMafIterator::writeBlock(). Duplicated sequence for species '" + genotypes_[g] + ",."); else { int state = (*sequences[0])[i]; if (AlphabetTools::DNA_ALPHABET.isGap(state) || AlphabetTools::DNA_ALPHABET.isUnresolved(state)) out << "\t."; else out << "\t" << snps[state]; } } } out << endl; } } } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/DuplicateFilterMafIterator.cpp000664 001750 001750 00000006211 12372454303 026715 0ustar00jdutheiljdutheil000000 000000 // // File: DuplicateFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "DuplicateFilterMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* DuplicateFilterMafIterator::analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); while (currentBlock_) { bool foundRef = false; string chr = ""; char strand = '+'; size_t start = 0; size_t stop = 0; for (size_t i = 0; i < currentBlock_->getNumberOfSequences() && !foundRef; ++i) { string species = currentBlock_->getSequence(i).getSpecies(); if (species == ref_) { foundRef = true; chr = currentBlock_->getSequence(i).getChromosome(); strand = currentBlock_->getSequence(i).getStrand(); start = currentBlock_->getSequence(i).start(); stop = currentBlock_->getSequence(i).stop(); } } if (!foundRef) { if (logstream_) { (*logstream_ << "DUPLICATE FILTER: block does not contain reference species and was removed.").endLine(); } delete currentBlock_; } else { size_t occurrence = blocks_[chr][strand][start][stop]++; if (occurrence > 0) { if (logstream_) { (*logstream_ << "DUPLICATE FILTER: sequence in reference species was found in a previous block. New block was removed.").endLine(); } delete currentBlock_; } else { return currentBlock_; } } //Look for the next block: currentBlock_ = iterator_->nextBlock(); } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/ChromosomeMafIterator.h000664 001750 001750 00000005566 12372454303 025431 0ustar00jdutheiljdutheil000000 000000 // // File: ChromosomeMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _CHROMOSOMEMAFITERATOR_H_ #define _CHROMOSOMEMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to keep only the block corresponding to one chromosome (of a reference sequence). */ class ChromosomeMafIterator: public AbstractFilterMafIterator { private: std::string ref_; std::string chr_; public: /** * @param iterator The input iterator. * @param reference The reference species name. * @param chr the chromosome name to filter. */ ChromosomeMafIterator(MafIterator* iterator, const std::string& reference, const std::string& chr) : AbstractFilterMafIterator(iterator), ref_(reference), chr_(chr) {} private: ChromosomeMafIterator(const ChromosomeMafIterator& iterator) : AbstractFilterMafIterator(0), ref_(iterator.ref_), chr_(iterator.chr_) {} ChromosomeMafIterator& operator=(const ChromosomeMafIterator& iterator) { ref_ = iterator.ref_; chr_ = iterator.chr_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_CHROMOSOMEMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/FullGapFilterMafIterator.h000664 001750 001750 00000005266 12372454303 026013 0ustar00jdutheiljdutheil000000 000000 // // File: FullGapFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _FULLGAPFILTERMAFITERATOR_H_ #define _FULLGAPFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to remove in each block the positions made only of gaps. * * The subset of species that should be examined is given as input. The coordinates of these * species will not be altered as only gap positions are removed. Other species however may be * altered as they might not have gap in the removed position. The coordinates for these species * will therefore be removed as they do not make sense anymore. */ class FullGapFilterMafIterator: public AbstractFilterMafIterator { private: std::vector species_; public: FullGapFilterMafIterator(MafIterator* iterator, const std::vector& species) : AbstractFilterMafIterator(iterator), species_(species) {} private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_FULLGAPFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/SequenceStreamToMafIterator.cpp000664 001750 001750 00000005565 12372454303 027077 0ustar00jdutheiljdutheil000000 000000 // // File: MafAlignmentParser.h // Authors: Julien Dutheil // Created: Tue Apr 27 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "SequenceStreamToMafIterator.h" #include #include using namespace std; using namespace bpp; MafBlock* SequenceStreamToMafIterator::analyseCurrentBlock_() throw (Exception) { auto_ptr block(new MafBlock()); MafSequence mafSeq; if (stream_->eof()) return 0; seqStream_->nextSequence(*stream_, mafSeq); //Check if sequence name contains meta information: string meta = mafSeq.getName(); StringTokenizer st(meta, ":"); if (st.numberOfRemainingTokens() == 5) { string species = st.nextToken(); string chr = st.nextToken(); unsigned int start = TextTools::to(st.nextToken()); if (!zeroBasedCoords_) start--; string strand = st.nextToken(); unsigned int length = TextTools::to(st.nextToken()); mafSeq.setName(species + "." + chr); mafSeq.setStrand(strand[0]); mafSeq.setStart(start); if (mafSeq.size() != length) throw Exception("SequenceStreamToMafIterator::analyseCurrentBlock_. Sequence size does not match its header specification: expected " + TextTools::toString(length) + " and found " + TextTools::toString(mafSeq.size())); } block->addSequence(mafSeq); return block.release(); } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/CoordinatesOutputMafIterator.h000664 001750 001750 00000007045 12407765466 027021 0ustar00jdutheiljdutheil000000 000000 // // File: CoordinatesOutputMafIterator.h // Authors: Julien Dutheil // Created: Mon Jun 02 2014 // /* Copyright or © or Copr. Bio++ Development Team, (2014) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _COORDINATESOUTPUTMAFITERATOR_H_ #define _COORDINATESOUTPUTMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include namespace bpp { /** * @brief Output each sequence coordinates for each block. * * The set of species for which coordinates are output is provided as argument. * The current implementation outputs results as a table to a file. Later implementation * may involve a dedicated data structure for other application usage (file indexing and so one). */ class CoordinatesOutputMafIterator: public AbstractFilterMafIterator { private: std::ostream* output_; std::vector species_; public: /** * @brief Creates a new CoordinatesOutputMafIterator object. * * @param iterator The input iterator. * @param out A pointer toward the output stream. The stream will not be own by this instance, and will not be copied neither destroyed. * @param species A vector of species names for which coordinates should be output. In case of missing species for one block, NA will be produced. */ CoordinatesOutputMafIterator(MafIterator* iterator, std::ostream* out, const std::vector& species): AbstractFilterMafIterator(iterator), output_(out), species_(species) { if (output_) writeHeader_(*output_); } private: CoordinatesOutputMafIterator(const CoordinatesOutputMafIterator& iterator) : AbstractFilterMafIterator(0), output_(iterator.output_), species_(iterator.species_) {} CoordinatesOutputMafIterator& operator=(const CoordinatesOutputMafIterator& iterator) { output_ = iterator.output_; species_ = iterator.species_; return *this; } private: void writeHeader_(std::ostream& out) const; MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_COORDINATESOUTPUTMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/ConcatenateMafIterator.h000664 001750 001750 00000006116 12372454303 025532 0ustar00jdutheiljdutheil000000 000000 // // File: ConcatenateMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _CONCATENATEMAFITERATOR_H_ #define _CONCATENATEMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Concatenate blocks up to a certain size. * * Blocks are appended regardless of their coordinates, to form concatenated blocks of at least a given number of positions. * The scores, if any, will be averaged for the block, weighted by the corresponding block sizes. * The pass value will be removed if it is different for the blocks. */ class ConcatenateMafIterator: public AbstractFilterMafIterator { private: MafBlock* incomingBlock_; unsigned int minimumSize_; public: ConcatenateMafIterator(MafIterator* iterator, unsigned int minimumSize) : AbstractFilterMafIterator(iterator), incomingBlock_(0), minimumSize_(minimumSize) { incomingBlock_ = iterator->nextBlock(); } private: ConcatenateMafIterator(const ConcatenateMafIterator& iterator) : AbstractFilterMafIterator(0), incomingBlock_(iterator.incomingBlock_), minimumSize_(iterator.minimumSize_) {} ConcatenateMafIterator& operator=(const ConcatenateMafIterator& iterator) { incomingBlock_ = iterator.incomingBlock_; minimumSize_ = iterator.minimumSize_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_CONCATENATEMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafSequence.h000664 001750 001750 00000017153 12407765466 023365 0ustar00jdutheiljdutheil000000 000000 // // File: MafSequence.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _MAFSEQUENCE_H_ #define _MAFSEQUENCE_H_ #include "../../Feature/SequenceFeature.h" #include #include #include namespace bpp { /** * @brief A sequence class which is used to store data from MAF files. * * It extends the SequenceWithAnnotation class to store MAF-specific features, * like the chromosome position. The sequence is its own listener, * and recomputes its "genomic" site by using the SequenceTools::getNumberOfSites * function when a content modification is performed. * Tags like begin and stop, hovever, have to be set by hand. * * A MAF sequence is necessarily a DNA sequence. */ class MafSequence: public SequenceWithAnnotation { private: bool hasCoordinates_; size_t begin_; std::string species_; std::string chromosome_; char strand_; size_t size_; size_t srcSize_; public: MafSequence(): SequenceWithAnnotation(&AlphabetTools::DNA_ALPHABET), hasCoordinates_(false), begin_(0), species_(""), chromosome_(""), strand_(0), size_(0), srcSize_(0) { size_ = 0; } MafSequence(const std::string& name, const std::string& sequence, bool parseName = true): SequenceWithAnnotation(name, sequence, &AlphabetTools::DNA_ALPHABET), hasCoordinates_(false), begin_(0), species_(""), chromosome_(""), strand_(0), size_(0), srcSize_(0) { size_ = SequenceTools::getNumberOfSites(*this); if (parseName) splitNameIntoSpeciesAndChromosome(name, species_, chromosome_); } MafSequence(const std::string& name, const std::string& sequence, size_t begin, char strand, size_t srcSize, bool parseName = true) : SequenceWithAnnotation(name, sequence, &AlphabetTools::DNA_ALPHABET), hasCoordinates_(true), begin_(begin), species_(""), chromosome_(""), strand_(strand), size_(0), srcSize_(srcSize) { size_ = SequenceTools::getNumberOfSites(*this); if (parseName) splitNameIntoSpeciesAndChromosome(name, species_, chromosome_); } MafSequence* clone() const { return new MafSequence(*this); } ~MafSequence() {} public: bool hasCoordinates() const { return hasCoordinates_; } void removeCoordinates() { hasCoordinates_ = false; begin_ = 0; } size_t start() const throw (Exception) { if (hasCoordinates_) return begin_; else throw Exception("MafSequence::start(). Sequence " + getName() + " does not have coordinates."); } size_t stop() const { if (hasCoordinates_) return begin_ + size_; else throw Exception("MafSequence::stop(). Sequence " + getName() + " does not have coordinates."); } /** * @return A range with cooridinates from this sequence. * @param origin Tell if coorinates according to original sequence should be used. * If 'yes' and the sequence is on the negative strand, the returned rang will be computed as [SrcSize-Stop, SrcSize-Start[ */ Range getRange(bool origin=true) const { if (hasCoordinates_) { if (origin && strand_ == '-') { return Range(srcSize_ - stop(), srcSize_ - start()); } else { return Range(start(), stop()); } } else throw Exception("MafSequence::getRange(). Sequence " + getName() + " does not have coordinates."); } void setName(const std::string& name) { try { splitNameIntoSpeciesAndChromosome(name, species_, chromosome_); } catch (Exception& e) { species_ = ""; chromosome_ = ""; } SequenceWithAnnotation::setName(name); } static void splitNameIntoSpeciesAndChromosome(const std::string& name, std::string& species, std::string& chr) { size_t pos = name.find("."); if (pos != std::string::npos) { chr = name.substr(pos + 1); species = name.substr(0, pos); } else { throw Exception("MafSequence::splitNameIntospeciesAndChromosome(). Invalid sequence name: " + name); } } const std::string& getSpecies() const { return species_; } const std::string& getChromosome() const { return chromosome_; } char getStrand() const { return strand_; } size_t getGenomicSize() const { return size_; } size_t getSrcSize() const { return srcSize_; } void setStart(size_t begin) { begin_ = begin; hasCoordinates_ = true; } void setChromosome(const std::string& chr) { chromosome_ = chr; SequenceWithAnnotation::setName(species_ + "." + chromosome_); } void setSpecies(const std::string& species) { species_ = species; SequenceWithAnnotation::setName(species_ + "." + chromosome_); } void setStrand(char s) { strand_ = s; } void setSrcSize(size_t srcSize) { srcSize_ = srcSize; } std::string getDescription() const { return getName() + strand_ + ":" + (hasCoordinates_ ? TextTools::toString(start()) + "-" + TextTools::toString(stop()) : "?-?"); } /** * @brief Extract a sub-sequence. * * @return A subsequence. * @param startAt Begining of sub-sequence. * @param length the length of the sub-sequence. */ MafSequence* subSequence(size_t startAt, size_t length) const; private: void beforeSequenceChanged(const SymbolListEditionEvent& event) {} void afterSequenceChanged(const SymbolListEditionEvent& event) { size_ = SequenceTools::getNumberOfSites(*this); } void beforeSequenceInserted(const SymbolListInsertionEvent& event) {} void afterSequenceInserted(const SymbolListInsertionEvent& event) { size_ = SequenceTools::getNumberOfSites(*this); } void beforeSequenceDeleted(const SymbolListDeletionEvent& event) {} void afterSequenceDeleted(const SymbolListDeletionEvent& event) { size_ = SequenceTools::getNumberOfSites(*this); } void beforeSequenceSubstituted(const SymbolListSubstitutionEvent& event) {} void afterSequenceSubstituted(const SymbolListSubstitutionEvent& event) {} }; } // end of namespace bpp. #endif //_MAFSEQUENCE_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/CoordinatesOutputMafIterator.cpp000664 001750 001750 00000005443 12407765466 027354 0ustar00jdutheiljdutheil000000 000000 // // File: CoordinatesOutputMafIterator.cpp // Authors: Julien Dutheil // Created: Mon Jun 02 2014 // /* Copyright or © or Copr. Bio++ Development Team, (2014) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "CoordinatesOutputMafIterator.h" using namespace bpp; using namespace std; void CoordinatesOutputMafIterator::writeHeader_(ostream& out) const { for (size_t i = 0; i < species_.size(); ++i) { if (i > 0) out << "\t"; string sp = species_[i]; out << sp << ".chr\t" << sp << ".strand\t" << sp << ".start\t" << sp << ".stop"; } out << endl; } MafBlock* CoordinatesOutputMafIterator::analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); if (currentBlock_) { for (size_t i = 0; i < species_.size(); ++i) { if (i > 0) *output_ << "\t"; vector seqs = currentBlock_->getSequencesForSpecies(species_[i]); if (seqs.size() > 1) throw Exception("CoordinatesOutputMafIterator::analyseCurrentBlock_(). There is more than one sequence for species '" + species_[i] + "' in current block."); else if (seqs.size() == 0) { *output_ << "NA\tNA\tNA\tNA"; } else { *output_ << seqs[0]->getChromosome() << "\t" << seqs[0]->getStrand() << "\t" << seqs[0]->start() << "\t" << seqs[0]->stop(); } } *output_ << endl; } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/ConcatenateMafIterator.cpp000664 001750 001750 00000012151 12372454303 026061 0ustar00jdutheiljdutheil000000 000000 // // File: ConcatenateMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "ConcatenateMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* ConcatenateMafIterator::analyseCurrentBlock_() throw (Exception) { if (!incomingBlock_) return 0; currentBlock_ = incomingBlock_; incomingBlock_ = iterator_->nextBlock(); while (incomingBlock_) { if (currentBlock_->getNumberOfSites() >= minimumSize_) { return currentBlock_; } //We merge the two blocks: vector sp1 = currentBlock_->getSpeciesList(); vector sp2 = incomingBlock_->getSpeciesList(); vector allSp = VectorTools::unique(VectorTools::vectorUnion(sp1, sp2)); //We need to create a new MafBlock: MafBlock* mergedBlock = new MafBlock(); //We average the score and pass values: unsigned int p1 = currentBlock_->getPass(); unsigned int p2 = incomingBlock_->getPass(); if (p1 == p2) mergedBlock->setPass(p1); double s1 = currentBlock_->getScore(); double n1 = static_cast(currentBlock_->getNumberOfSites()); double s2 = incomingBlock_->getScore(); double n2 = static_cast(incomingBlock_->getNumberOfSites()); mergedBlock->setScore((s1 * n1 + s2 * n2) / (n1 + n2)); //Now fill the new block: for (size_t i = 0; i < allSp.size(); ++i) { auto_ptr seq; try { seq.reset(new MafSequence(currentBlock_->getSequenceForSpecies(allSp[i]))); //Check is there is a second sequence: try { auto_ptr tmp(new MafSequence(incomingBlock_->getSequenceForSpecies(allSp[i]))); string ref1 = seq->getDescription(), ref2 = tmp->getDescription(); if (seq->getChromosome() != tmp->getChromosome()) { seq->setChromosome("fus"); seq->removeCoordinates(); } if (seq->getStrand() != tmp->getStrand()) { seq->setStrand('?'); seq->removeCoordinates(); } if (seq->getName() != tmp->getName()) tmp->setName(seq->getName()); //force name conversion to prevent exception in 'merge'. seq->merge(*tmp); if (logstream_) { (*logstream_ << "BLOCK CONCATENATE: merging " << ref1 << " with " << ref2 << " into " << seq->getDescription()).endLine(); } } catch (SequenceNotFoundException& snfe2) { //There was a first sequence, we just extend it: string ref1 = seq->getDescription(); seq->setToSizeR(seq->size() + incomingBlock_->getNumberOfSites()); if (logstream_) { (*logstream_ << "BLOCK CONCATENATE: extending " << ref1 << " with " << incomingBlock_->getNumberOfSites() << " gaps on the right.").endLine(); } } } catch (SequenceNotFoundException& snfe1) { //There must be a second sequence then: seq.reset(new MafSequence(incomingBlock_->getSequenceForSpecies(allSp[i]))); string ref2 = seq->getDescription(); seq->setToSizeL(seq->size() + currentBlock_->getNumberOfSites()); if (logstream_) { (*logstream_ << "BLOCK CONCATENATE: adding " << ref2 << " and extend it with " << currentBlock_->getNumberOfSites() << " gaps on the left.").endLine(); } } mergedBlock->addSequence(*seq); } //Cleaning stuff: delete currentBlock_; delete incomingBlock_; currentBlock_ = mergedBlock; //We check if we can also merge the next block: incomingBlock_ = iterator_->nextBlock(); } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/EntropyFilterMafIterator.cpp000664 001750 001750 00000021415 12407765466 026464 0ustar00jdutheiljdutheil000000 000000 // // File: EntropyFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "EntropyFilterMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* EntropyFilterMafIterator::analyseCurrentBlock_() throw (Exception) { if (blockBuffer_.size() == 0) { //Else there is no more block in the buffer, we need to parse more: do { MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. //Parse block. int gap = AlphabetTools::DNA_ALPHABET.getGapCharacterCode(); //unused for now //int unk = AlphabetTools::DNA_ALPHABET.getUnknownCharacterCode(); size_t nr; size_t nc = static_cast(block->getNumberOfSites()); vector< vector > aln; if (missingAsGap_ && !ignoreGaps_) { nr = species_.size(); aln.resize(nr); for (size_t i = 0; i < nr; ++i) { if (block->hasSequenceForSpecies(species_[i])) aln[i] = block->getSequenceForSpecies(species_[i]).getContent(); else { aln[i].resize(nc); fill(aln[i].begin(), aln[i].end(), gap); } } } else { vector speciesSet = VectorTools::vectorIntersection(species_, block->getSpeciesList()); nr = speciesSet.size(); aln.resize(nr); for (size_t i = 0; i < nr; ++i) { aln[i] = block->getSequenceForSpecies(species_[i]).getContent(); } } //First we create a mask: vector pos; //Reset window: window_.clear(); //Init window: size_t i; for (i = 0; i < windowSize_; ++i) { vector col; for (size_t j = 0; j < nr; ++j) { int x = aln[j][i]; if (x != gap || !ignoreGaps_) col.push_back(x); } double entropy = VectorTools::shannonDiscrete(col) / log(5.); window_.push_back(entropy > maxEnt_ ? 1 : 0); } //Slide window: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Sliding window for entropy filter", true); } while (i + step_ < nc) { if (verbose_) ApplicationTools::displayGauge(i - windowSize_, nc - windowSize_ - 1, '>'); //Evaluate current window: unsigned int count = std::accumulate(window_.begin(), window_.end(), 0u); if (count > maxPos_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ < pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } //Move forward: for (size_t k = 0; k < step_; ++k) { vector col; for (size_t j = 0; j < nr; ++j) { int x = aln[j][i]; if (x != gap || !ignoreGaps_) col.push_back(x); } double entropy = VectorTools::shannonDiscrete(col) / log(5.); window_.push_back(entropy > maxEnt_ ? 1 : 0); window_.pop_front(); ++i; } } //Evaluate last window: unsigned int count = std::accumulate(window_.begin(), window_.end(), 0u); if (count > maxPos_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ <= pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } if (verbose_) ApplicationTools::displayTaskDone(); //Now we remove regions with two many gaps, using a sliding window: if (pos.size() == 0) { blockBuffer_.push_back(block); if (logstream_) { (*logstream_ << "ENTROPY CLEANER: block " << block->getDescription() << " is clean and kept as is.").endLine(); } } else if (pos.size() == 2 && pos.front() == 0 && pos.back() == block->getNumberOfSites()) { //Everything is removed: if (logstream_) { (*logstream_ << "ENTROPY CLEANER: block " << block->getDescription() << " was entirely removed. Tried to get the next one.").endLine(); } } else { if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " with size "<< block->getNumberOfSites() << " will be split into " << (pos.size() / 2 + 1) << " blocks.").endLine(); } if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Spliting block", true); } for (i = 0; i < pos.size(); i+=2) { if (verbose_) ApplicationTools::displayGauge(i, pos.size() - 2, '='); if (logstream_) { (*logstream_ << "ENTROPY CLEANER: removing region (" << pos[i] << ", " << pos[i+1] << ") from block " << block->getDescription() << ".").endLine(); } if (pos[i] > 0) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; if (i == 0) { subseq = block->getSequence(j).subSequence(0, pos[i]); } else { subseq = block->getSequence(j).subSequence(pos[i - 1], pos[i] - pos[i - 1]); } newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (keepTrashedBlocks_) { MafBlock* outBlock = new MafBlock(); outBlock->setScore(block->getScore()); outBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* outseq = block->getSequence(j).subSequence(pos[i], pos[i + 1] - pos[i]); outBlock->addSequence(*outseq); delete outseq; } trashBuffer_.push_back(outBlock); } } //Add last block: if (pos[pos.size() - 1] < block->getNumberOfSites()) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; subseq = block->getSequence(j).subSequence(pos[pos.size() - 1], block->getNumberOfSites() - pos[pos.size() - 1]); newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); delete block; } } while (blockBuffer_.size() == 0); } MafBlock* block = blockBuffer_.front(); blockBuffer_.pop_front(); return block; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/OrphanSequenceFilterMafIterator.h000664 001750 001750 00000007202 12407766064 027402 0ustar00jdutheiljdutheil000000 000000 // // File: OrphanSequenceFilterMafIterator.h // Authors: Julien Dutheil // Created: Mon Mar 11 2013 // /* Copyright or © or Copr. Bio++ Development Team, (2013) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _ORPHANSEQUENCEFILTERMAFITERATOR_H_ #define _ORPHANSEQUENCEFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to keep a the ones which display a specified combination of species. * * This filter is typically used to retrieve "orphan" sequences, that is sequences only present in one (set of) species. */ class OrphanSequenceFilterMafIterator: public AbstractFilterMafIterator { private: std::vector species_; bool strict_; bool rmDuplicates_; public: /** * @param iterator The input iterator. * @param species The list of species names to be retained. * @param strict If true, then block that do not contain all of the specified species will be discarded. * @param keep If true, then additional species sequences will be kept. * @param rmDuplicates If true, block that contain more than one instance for at least one species will be discarded. */ OrphanSequenceFilterMafIterator(MafIterator* iterator, const std::vector& species, bool strict = false, bool keep = false, bool rmDuplicates = false) : AbstractFilterMafIterator(iterator), species_(species), strict_(strict), rmDuplicates_(rmDuplicates) {} private: OrphanSequenceFilterMafIterator(const OrphanSequenceFilterMafIterator& iterator) : AbstractFilterMafIterator(0), species_(iterator.species_), strict_(iterator.strict_), rmDuplicates_(iterator.rmDuplicates_) {} OrphanSequenceFilterMafIterator& operator=(const OrphanSequenceFilterMafIterator& iterator) { species_ = iterator.species_; strict_ = iterator.strict_; rmDuplicates_ = iterator.rmDuplicates_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_ORPHANSEQUENCEFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/SequenceFilterMafIterator.cpp000664 001750 001750 00000007550 12372454303 026562 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "SequenceFilterMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* SequenceFilterMafIterator::analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); while (currentBlock_) { map counts; for (size_t i = currentBlock_->getNumberOfSequences(); i > 0; --i) { string species = currentBlock_->getSequence(i-1).getSpecies(); if (!VectorTools::contains(species_, species)) { if (logstream_) { (*logstream_ << "SEQUENCE FILTER: remove sequence '" << species << "' from current block " << currentBlock_->getDescription() << ".").endLine(); } if (!keep_) { currentBlock_->getAlignment().deleteSequence(i - 1); } } else { counts[species]++; } } bool test = currentBlock_->getNumberOfSequences() == 0; //Avoid a memory leak: if (test) { if (logstream_) { (*logstream_ << "SEQUENCE FILTER: block " << currentBlock_->getDescription() << " is now empty. Try to get the next one.").endLine(); } delete currentBlock_; } else { test = strict_ && (counts.size() != species_.size()); if (test) { if (logstream_) { (*logstream_ << "SEQUENCE FILTER: block " << currentBlock_->getDescription() << " does not contain all species and will be ignored. Try to get the next one.").endLine(); } delete currentBlock_; } else { if (rmDuplicates_) { test = false; map::iterator it; for (it = counts.begin(); it != counts.end() && !(test = it->second > 1); it++) {} if (test) { if (logstream_) { (*logstream_ << "SEQUENCE FILTER: block " << currentBlock_->getDescription() << " has two sequences for species '" << it->first << "' and will be ignored. Try to get the next one.").endLine(); } delete currentBlock_; } else { return currentBlock_; } } else { return currentBlock_; } } } //Look for the next block: currentBlock_ = iterator_->nextBlock(); } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/OutputAlignmentMafIterator.h000664 001750 001750 00000013124 12407765466 026460 0ustar00jdutheiljdutheil000000 000000 // // File: OutputAlignmentMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _OUTPUTALIGNMENTMAFITERATOR_H_ #define _OUTPUTALIGNMENTMAFITERATOR_H_ #include "MafIterator.h" //From bpp-seq: #include //From the STL: #include #include #include namespace bpp { /** * @brief This iterator forward the iterator given as input after having printed its content to an alignment file. * The syntax for ENSEMBL meta data is used. */ class OutputAlignmentMafIterator: public AbstractFilterMafIterator { private: std::ostream* output_; std::string file_; bool mask_; std::auto_ptr writer_; unsigned int currentBlockIndex_; public: /** * @brief Creates a new OutputAlignmentMafIterator object. * * All block will be printed as separate alignment, yet one after the other on the stream. * Be aware that not all format will recognize the resulting file as a multiple alignment file (Mase and Clustal will for instance, not Fasta). * @param iterator The input iterator * @param out A pointer toward the output stream. The stream will not be own by this instance, and will not be copied neither destroyed. * @param writer A pointer toward an alignment writer object which specifies the format to use when writing sequences. * The underlying object will be own by this instance, and destroyed when this object is deleted. * @param mask Tell if sequences should be printed masked (if applicable). */ OutputAlignmentMafIterator(MafIterator* iterator, std::ostream* out, OAlignment* writer, bool mask = true) : AbstractFilterMafIterator(iterator), output_(out), file_(), mask_(mask), writer_(writer), currentBlockIndex_(0) { if (!writer) throw Exception("OutputAlignmentMafIterator (constructor 1): sequence writer should not be a NULL pointer!"); } /** * @brief Creates a new OutputAlignmentMafIterator object. * * All block will be printed as separate alignment, yet one after the other on the stream. * Be aware that not all format will recognize the resulting file as a multiple alignment file (Mase and Clustal will for instance, not Fasta). * @param iterator The input iterator * @param file A string describing the path to the output files. Each block will be written to a distinct file. * If "file" is a fixed string, it will only contain the last block. Using the %i code in the file name allows to generate one file per block, %i denoting the block index. * @param writer A pointer toward an alignment writer object which specifies the format to use when writing sequences. * The underlying object will be own by this instance, and destroyed when this object is deleted. * @param mask Tell if sequences should be printed masked (if applicable). */ OutputAlignmentMafIterator(MafIterator* iterator, const std::string& file, OAlignment* writer, bool mask = true) : AbstractFilterMafIterator(iterator), output_(0), file_(file), mask_(mask), writer_(writer), currentBlockIndex_(0) { if (!writer) throw Exception("OutputAlignmentMafIterator (constructor 2): sequence writer should not be a NULL pointer!"); } ~OutputAlignmentMafIterator() {} private: OutputAlignmentMafIterator(const OutputAlignmentMafIterator& iterator) : AbstractFilterMafIterator(0), output_(iterator.output_), file_(iterator.file_), mask_(iterator.mask_), writer_(), currentBlockIndex_(iterator.currentBlockIndex_) {} OutputAlignmentMafIterator& operator=(const OutputAlignmentMafIterator& iterator) { output_ = iterator.output_; file_ = iterator.file_; mask_ = iterator.mask_; writer_.release(); currentBlockIndex_ = iterator.currentBlockIndex_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); void writeBlock(std::ostream& out, const MafBlock& block) const; }; } // end of namespace bpp. #endif //_OUTPUTALIGNMENTMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/BlockSizeMafIterator.h000664 001750 001750 00000005476 12372454303 025203 0ustar00jdutheiljdutheil000000 000000 // // File: BlockSizeMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _BLOCKSIZEMAFITERATOR_H_ #define _BLOCKSIZEMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to keep only the ones with a minimum number of species. */ class BlockSizeMafIterator: public AbstractFilterMafIterator { private: unsigned int minSize_; public: BlockSizeMafIterator(MafIterator* iterator, unsigned int minSize) : AbstractFilterMafIterator(iterator), minSize_(minSize) {} private: MafBlock* analyseCurrentBlock_() throw (Exception) { bool test; do { currentBlock_ = iterator_->nextBlock(); if (!currentBlock_) break; test = (currentBlock_->getNumberOfSequences() < minSize_); if (test) { if (logstream_) { (*logstream_ << "BLOCK SIZE FILTER: block " << currentBlock_->getDescription() << " with size " << currentBlock_->getNumberOfSites() << " was discarded.").endLine(); } delete currentBlock_; currentBlock_ = 0; } } while (test); return currentBlock_; } }; } // end of namespace bpp. #endif //_BLOCKSIZEMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/FullGapFilterMafIterator.cpp000664 001750 001750 00000007171 12372454303 026343 0ustar00jdutheiljdutheil000000 000000 // // File: FullGapFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "FullGapFilterMafIterator.h" //From bpp-seq #include #include using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* FullGapFilterMafIterator::analyseCurrentBlock_() throw (Exception) { MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //We create a copy of the ingroup alignement for better efficiency: VectorSiteContainer vsc(&AlphabetTools::DNA_ALPHABET); for (size_t i = 0; i < species_.size(); ++i) { vsc.addSequence(block->getSequence(i)); } //Now check the positions that are only made of gaps: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Cleaning block for gap sites", true); } size_t n = block->getNumberOfSites(); vector start; vector count; bool test = false; for (size_t i = 0; i < n; ++i) { const Site* site = &vsc.getSite(i); if (SiteTools::isGapOnly(*site)) { if (test) { count[count.size() - 1]++; } else { start.push_back(i); count.push_back(1); test = true; } } else { test = false; } } //Now remove blocks: size_t totalRemoved = 0; for(size_t i = start.size(); i > 0; --i) { if (verbose_) ApplicationTools::displayGauge(start.size() - i, start.size() - 1, '='); block->getAlignment().deleteSites(start[i - 1], count[i - 1]); totalRemoved += count[i - 1]; } if (verbose_) ApplicationTools::displayTaskDone(); //Correct coordinates: if (totalRemoved > 0) { for (size_t i = 0; i < block->getNumberOfSequences(); ++i) { const MafSequence* seq = &block->getSequence(i); if (!VectorTools::contains(species_, seq->getSpecies())) { block->removeCoordinatesFromSequence(i); } } } if (logstream_) { (*logstream_ << "FULL GAP CLEANER: " << totalRemoved << " positions have been removed.").endLine(); } return block; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/OutputMafIterator.cpp000664 001750 001750 00000011761 12372454303 025143 0ustar00jdutheiljdutheil000000 000000 // // File: OutputMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "OutputMafIterator.h" //From bpp-seq: #include #include using namespace bpp; //From the STL: #include #include using namespace std; void OutputMafIterator::writeHeader(std::ostream& out) const { out << "##maf version=1 program=Bio++" << endl << "#" << endl; //There are more options in the header that we may want to support... } void OutputMafIterator::writeBlock(std::ostream& out, const MafBlock& block) const { out << "a"; if (! isinf(block.getScore())) out << " score=" << block.getScore(); if (block.getPass() > 0) out << " pass=" << block.getPass(); out << endl; //Now we write sequences. First need to count characters for aligning blocks: size_t mxcSrc = 0, mxcStart = 0, mxcSize = 0, mxcSrcSize = 0; for (size_t i = 0; i < block.getNumberOfSequences(); i++) { const MafSequence* seq = &block.getSequence(i); size_t start = 0; //Maybe we should output sthg else here? if (seq->hasCoordinates()) start = seq->start(); mxcSrc = max(mxcSrc , seq->getName().size()); mxcStart = max(mxcStart , TextTools::toString(start).size()); mxcSize = max(mxcSize , TextTools::toString(seq->getGenomicSize()).size()); mxcSrcSize = max(mxcSrcSize, TextTools::toString(seq->getSrcSize()).size()); } //Now print each sequence: for (size_t i = 0; i < block.getNumberOfSequences(); i++) { const MafSequence* seq = &block.getSequence(i); out << "s "; out << TextTools::resizeRight(seq->getName(), mxcSrc, ' ') << " "; size_t start = 0; //Maybe we should output sthg else here? if (seq->hasCoordinates()) start = seq->start(); out << TextTools::resizeLeft(TextTools::toString(start), mxcStart, ' ') << " "; out << TextTools::resizeLeft(TextTools::toString(seq->getGenomicSize()), mxcSize, ' ') << " "; out << seq->getStrand() << " "; out << TextTools::resizeLeft(TextTools::toString(seq->getSrcSize()), mxcSrcSize, ' ') << " "; //Shall we write the sequence as masked? string seqstr = seq->toString(); if (mask_ && seq->hasAnnotation(SequenceMask::MASK)) { const SequenceMask* mask = &dynamic_cast(seq->getAnnotation(SequenceMask::MASK)); for (size_t j = 0; j < seqstr.size(); ++j) { char c = ((*mask)[j] ? static_cast(tolower(static_cast(seqstr[j]))) : seqstr[j]); out << c; } } else { out << seqstr; } out << endl; //Write quality scores if any: if (mask_ && seq->hasAnnotation(SequenceQuality::QUALITY_SCORE)) { const SequenceQuality* qual = &dynamic_cast(seq->getAnnotation(SequenceQuality::QUALITY_SCORE)); out << "q "; out << TextTools::resizeRight(seq->getName(), mxcSrc + mxcStart + mxcSize + mxcSrcSize + 5, ' ') << " "; string qualStr; for (size_t j = 0; j < seq->size(); ++j) { int s = (*qual)[j]; if (s == -1) { qualStr += "-"; } else if (s == -2) { qualStr += "?"; } else if (s >=0 && s < 10) { qualStr += TextTools::toString(s); } else if (s == 10) { qualStr += "F"; } else { throw Exception("MafAlignmentParser::writeBlock. Unsuported score value: " + TextTools::toString(s)); } } out << qualStr << endl; } } out << endl; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/OutputAlignmentMafIterator.cpp000664 001750 001750 00000006350 12407765466 027016 0ustar00jdutheiljdutheil000000 000000 // // File: OutputAlignmentMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "OutputAlignmentMafIterator.h" //From bpp-seq: #include using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* OutputAlignmentMafIterator::analyseCurrentBlock_() throw (Exception) { MafBlock* block = iterator_->nextBlock(); if (block) { if (output_) { writeBlock(*output_, *block); } else { string file = file_; TextTools::replaceAll(file, "%i", TextTools::toString(++currentBlockIndex_)); std::ofstream output(file.c_str(), ios::out); writeBlock(output, *block); } } return block; } void OutputAlignmentMafIterator::writeBlock(std::ostream& out, const MafBlock& block) const { //First get alignment: AlignedSequenceContainer aln(&AlphabetTools::DNA_ALPHABET); //We cannot copy directly the container because we want to convert from MafSequence to BasicSequence (needed for renaiming): SequenceContainerTools::convertContainer(block.getAlignment(), aln); //Format sequence names: vector names(aln.getNumberOfSequences()); for (size_t i = 0; i < aln.getNumberOfSequences(); ++i) { const MafSequence& mafseq = block.getSequence(i); if (mafseq.hasCoordinates()) names[i] = mafseq.getSpecies() + "-" + mafseq.getChromosome() + "(" + mafseq.getStrand() + ")/" + TextTools::toString(mafseq.start() + 1) + "-" + TextTools::toString(mafseq.stop() + 1); else names[i] = mafseq.getSpecies(); } aln.setSequencesNames(names); writer_->writeAlignment(out, aln); } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/IterationListener.h000664 001750 001750 00000010546 12372454303 024616 0ustar00jdutheiljdutheil000000 000000 // // File: IterationListener.h // Authors: Julien Dutheil // Created: Wed Jun 27 2012 // /* Copyright or © or Copr. Bio++ Development Team, (2012) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _ITERATIONLISTENER_H_ #define _ITERATIONLISTENER_H_ #include "MafIterator.h" #include "SequenceStatisticsMafIterator.h" namespace bpp { /** * @brief Listener which enable to catch events when parsing a Maf file. */ class IterationListener { public: virtual ~IterationListener() {} public: virtual void iterationStarts() = 0; virtual void iterationMoves(const MafBlock& currentBlock) = 0; virtual void iterationStops() = 0; }; /** * @brief Iteration listener that works with a SequenceStatisticsMafIterator, * enabling output of results in a file (partial implementation, format-independent) */ class AbstractStatisticsOutputIterationListener: public virtual IterationListener { protected: SequenceStatisticsMafIterator* statsIterator_; public: AbstractStatisticsOutputIterationListener(SequenceStatisticsMafIterator* iterator): statsIterator_(iterator) {} AbstractStatisticsOutputIterationListener(const AbstractStatisticsOutputIterationListener& listener): statsIterator_(listener.statsIterator_) {} AbstractStatisticsOutputIterationListener& operator=(const AbstractStatisticsOutputIterationListener& listener) { statsIterator_ = listener.statsIterator_; return *this; } virtual ~AbstractStatisticsOutputIterationListener() {} }; /** * @brief Iteration listener that works with a SequenceStatisticsMafIterator, * enabling output of results in a file in CSv format */ class CsvStatisticsOutputIterationListener: public AbstractStatisticsOutputIterationListener { private: OutputStream* output_; std::string sep_; std::string refSpecies_; public: CsvStatisticsOutputIterationListener(SequenceStatisticsMafIterator* iterator, const std::string& refSpecies, OutputStream* output, const std::string& sep = "\t"): AbstractStatisticsOutputIterationListener(iterator), output_(output), sep_(sep), refSpecies_(refSpecies) {} CsvStatisticsOutputIterationListener(const CsvStatisticsOutputIterationListener& listener): AbstractStatisticsOutputIterationListener(listener), output_(listener.output_), sep_(listener.sep_), refSpecies_(listener.refSpecies_) {} CsvStatisticsOutputIterationListener& operator=(const CsvStatisticsOutputIterationListener& listener) { AbstractStatisticsOutputIterationListener::operator=(listener); output_ = listener.output_; sep_ = listener.sep_; refSpecies_ = listener.refSpecies_; return *this; } virtual ~CsvStatisticsOutputIterationListener() {} public: virtual void iterationStarts(); virtual void iterationMoves(const MafBlock& currentBlock); virtual void iterationStops() {} }; } //end of namespace bpp. #endif //_ITERATIONLISTENER_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/SequenceStatisticsMafIterator.cpp000664 001750 001750 00000006043 12407765466 027501 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceStatisticsMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "SequenceStatisticsMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; SequenceStatisticsMafIterator::SequenceStatisticsMafIterator(MafIterator* iterator, const std::vector statistics) : AbstractFilterMafIterator(iterator), statistics_(statistics), results_(), names_() { string name; for (size_t i = 0; i < statistics_.size(); ++i) { name = statistics_[i]->getShortName(); vector tags = statistics_[i]->getSupportedTags(); if (tags.size() > 1) { for (size_t j = 0; j < tags.size(); ++j) { names_.push_back(name + "." + tags[j]); } } else { names_.push_back(name); } } results_.resize(names_.size()); } MafBlock* SequenceStatisticsMafIterator::analyseCurrentBlock_() throw (Exception) { vector tags; currentBlock_ = iterator_->nextBlock(); if (currentBlock_) { size_t k = 0; for (size_t i = 0; i < statistics_.size(); ++i) { statistics_[i]->compute(*currentBlock_); const MafStatisticsResult& result = statistics_[i]->getResult(); tags = statistics_[i]->getSupportedTags(); for (size_t j = 0; j < tags.size(); ++j) { if (result.hasValue(tags[j])) { results_[k] = result.getValue(tags[j]).clone(); } else { results_[k] = 0; } k++; } } } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafIterator.cpp000664 001750 001750 00000004704 12372454303 023721 0ustar00jdutheiljdutheil000000 000000 // // File: MafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "MafIterator.h" #include "IterationListener.h" using namespace bpp; //From the STL: #include #include using namespace std; void AbstractMafIterator::fireIterationStartSignal_() { for (std::vector::iterator it = iterationListeners_.begin(); it != iterationListeners_.end(); ++it) { (*it)->iterationStarts(); } } void AbstractMafIterator::fireIterationMoveSignal_(const MafBlock& currentBlock) { for (std::vector::iterator it = iterationListeners_.begin(); it != iterationListeners_.end(); ++it) { (*it)->iterationMoves(currentBlock); } } void AbstractMafIterator::fireIterationStopSignal_() { for (std::vector::iterator it = iterationListeners_.begin(); it != iterationListeners_.end(); ++it) { (*it)->iterationStops(); } } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/FeatureFilterMafIterator.h000664 001750 001750 00000006417 12372454303 026053 0ustar00jdutheiljdutheil000000 000000 // // File: FeatureFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _FEATUREFILTERMAFITERATOR_H_ #define _FEATUREFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Remove from alignment all positions that fall within any feature from a list given as a SequenceFeatureSet object. * * Removed regions are outputed as a trash iterator. */ class FeatureFilterMafIterator: public AbstractFilterMafIterator, public MafTrashIterator { private: std::string refSpecies_; std::deque blockBuffer_; std::deque trashBuffer_; bool keepTrashedBlocks_; std::map > ranges_; public: FeatureFilterMafIterator(MafIterator* iterator, const std::string& refSpecies, const SequenceFeatureSet& features, bool keepTrashedBlocks) : AbstractFilterMafIterator(iterator), refSpecies_(refSpecies), blockBuffer_(), trashBuffer_(), keepTrashedBlocks_(keepTrashedBlocks), ranges_() { //Build ranges: std::set seqIds = features.getSequences(); for (std::set::iterator it = seqIds.begin(); it != seqIds.end(); ++it) { { features.fillRangeCollectionForSequence(*it, ranges_[*it]); } } } public: MafBlock* nextRemovedBlock() throw (Exception) { if (trashBuffer_.size() == 0) return 0; MafBlock* block = trashBuffer_.front(); trashBuffer_.pop_front(); return block; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_FEATUREFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/SequenceFilterMafIterator.h000664 001750 001750 00000007713 12372454303 026230 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _SEQUENCEFILTERMAFITERATOR_H_ #define _SEQUENCEFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to keep a subset of sequences, given their name. * this filter can also be used to filter block which contain a certain set of sequences. * * Typical usage: * - strict=yes, keep=no: extract the species from the list, only if all of them are present in a block. * - strict=no, keep=no: extract the species from the list, at least the one which are there. * - strict=yes, keep=yes: filter blocks to retain only the ones that contain at least all species from the list. * Blocks that are empty after the filtering are removed. */ class SequenceFilterMafIterator: public AbstractFilterMafIterator { private: std::vector species_; bool strict_; bool keep_; bool rmDuplicates_; public: /** * @param iterator The input iterator. * @param species The list of species names to be retained. * @param strict If true, then block that do not contain all species will be discarded. * @param keep If true, sequences not in the selection will be kept. * @param rmDuplicates If true, block that contain more than one instance for at least one species will be discarded. */ SequenceFilterMafIterator(MafIterator* iterator, const std::vector& species, bool strict = false, bool keep = false, bool rmDuplicates = false) : AbstractFilterMafIterator(iterator), species_(species), strict_(strict), keep_(keep), rmDuplicates_(rmDuplicates) {} private: SequenceFilterMafIterator(const SequenceFilterMafIterator& iterator) : AbstractFilterMafIterator(0), species_(iterator.species_), strict_(iterator.strict_), keep_(iterator.keep_), rmDuplicates_(iterator.rmDuplicates_) {} SequenceFilterMafIterator& operator=(const SequenceFilterMafIterator& iterator) { species_ = iterator.species_; strict_ = iterator.strict_; keep_ = iterator.keep_; rmDuplicates_ = iterator.rmDuplicates_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_SEQUENCEFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/BlockLengthMafIterator.h000664 001750 001750 00000005504 12372454303 025502 0ustar00jdutheiljdutheil000000 000000 // // File: BlockLengthMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _BLOCKLENGTHMAFITERATOR_H_ #define _BLOCKLENGTHMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to keep only the ones with a minimum number of sites. */ class BlockLengthMafIterator: public AbstractFilterMafIterator { private: size_t minLength_; public: BlockLengthMafIterator(MafIterator* iterator, size_t minLength) : AbstractFilterMafIterator(iterator), minLength_(minLength) {} private: MafBlock* analyseCurrentBlock_() throw (Exception) { bool test; do { currentBlock_ = iterator_->nextBlock(); if (!currentBlock_) break; test = (currentBlock_->getNumberOfSites() < minLength_); if (test) { if (logstream_) { (*logstream_ << "BLOCK LENGTH FILTER: block " << currentBlock_->getDescription() << " with size " << currentBlock_->getNumberOfSites() << " was discarded.").endLine(); } delete currentBlock_; currentBlock_ = 0; } } while (test); return currentBlock_; } }; } // end of namespace bpp. #endif //_BLOCKLENGTHMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/OrphanSequenceFilterMafIterator.cpp000664 001750 001750 00000006117 12372454303 027730 0ustar00jdutheiljdutheil000000 000000 // // File: OrphanSequenceFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Mon Mar 11 2013 // /* Copyright or © or Copr. Bio++ Development Team, (2013) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "OrphanSequenceFilterMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* OrphanSequenceFilterMafIterator::analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); while (currentBlock_) { map counts; for (size_t i = 0; i < currentBlock_->getNumberOfSequences(); ++i) { string species = currentBlock_->getSequence(i).getSpecies(); counts[species]++; } bool test = counts.size() <= species_.size(); if (test) { //We have to check that the species are the right one: bool loseCrit = false; bool strictCrit = true; bool duplicate = false; for (size_t i = 0; i < species_.size() && !duplicate; ++i) { map::iterator it = counts.find(species_[i]); if (it != counts.end()) { loseCrit = true; if (rmDuplicates_ && it->second > 1) { //Duplicated sequences, block is discarded if asked to... duplicate = true; } } else { strictCrit = false; } } if (!duplicate) { //No duplicate found or duplicates are kept if (strictCrit || (!strict_ && loseCrit)) return currentBlock_; } } //Otherwise there is at least one extra species, we get the next block... currentBlock_ = iterator_->nextBlock(); } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/VcfOutputMafIterator.h000664 001750 001750 00000007364 12407765466 025271 0ustar00jdutheiljdutheil000000 000000 // // File: VcfOutputMafIterator.h // Authors: Julien Dutheil // Created: Tue Jan 05 2013 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _VCFOUTPUTMAFITERATOR_H_ #define _VCFOUTPUTMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief This iterator performs a simple SNP call from the MAF blocks, and outputs the results in the Variant Call Format (VCF). * * Only substitutions are supported for now. */ class VcfOutputMafIterator: public AbstractFilterMafIterator { private: std::ostream* output_; std::string refSpecies_; std::vector genotypes_; public: /** * @brief Build a new VcfOutputMafIterator object. * * @param iterator The input iterator. * @param out The output stream where to write the VCF file. * @param reference The species to use as a reference. * @param genotypes A list of species for which genotype information should be written in the VCF file. There will be one extra column per genotype, +1 format column. */ VcfOutputMafIterator(MafIterator* iterator, std::ostream* out, const std::string& reference, const std::vector& genotypes) : AbstractFilterMafIterator(iterator), output_(out), refSpecies_(reference), genotypes_(genotypes) { if (output_) writeHeader_(*output_); } private: VcfOutputMafIterator(const VcfOutputMafIterator& iterator) : AbstractFilterMafIterator(0), output_(iterator.output_), refSpecies_(iterator.refSpecies_), genotypes_(iterator.genotypes_) {} VcfOutputMafIterator& operator=(const VcfOutputMafIterator& iterator) { output_ = iterator.output_; refSpecies_ = iterator.refSpecies_; genotypes_ = iterator.genotypes_; return *this; } public: MafBlock* analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); if (output_ && currentBlock_) writeBlock_(*output_, *currentBlock_); return currentBlock_; } private: void writeHeader_(std::ostream& out) const; void writeBlock_(std::ostream& out, const MafBlock& block) const; }; } // end of namespace bpp. #endif //_VCFOUTPUTMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/QualityFilterMafIterator.h000664 001750 001750 00000006257 12372454303 026112 0ustar00jdutheiljdutheil000000 000000 // // File: QualityFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _QUALITYFILTERMAFITERATOR_H_ #define _QUALITYFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to remove regions with low quality. * * Regions with a too low average quality in a set of species will be removed, * and blocks adjusted accordingly. */ class QualityFilterMafIterator: public AbstractFilterMafIterator, public MafTrashIterator { private: std::vector species_; unsigned int windowSize_; unsigned int step_; unsigned int minQual_; std::deque blockBuffer_; std::deque trashBuffer_; std::deque< std::vector > window_; bool keepTrashedBlocks_; public: QualityFilterMafIterator(MafIterator* iterator, const std::vector& species, unsigned int windowSize, unsigned int step, unsigned int minQual, bool keepTrashedBlocks) : AbstractFilterMafIterator(iterator), species_(species), windowSize_(windowSize), step_(step), minQual_(minQual), blockBuffer_(), trashBuffer_(), window_(species.size()), keepTrashedBlocks_(keepTrashedBlocks) {} public: MafBlock* nextRemovedBlock() throw (Exception) { if (trashBuffer_.size() == 0) return 0; MafBlock* block = trashBuffer_.front(); trashBuffer_.pop_front(); return block; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_QUALITYFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/SequenceStreamToMafIterator.h000664 001750 001750 00000006121 12372454303 026531 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceStreamToMafIterator.h // Authors: Julien Dutheil // Created: Wed Oct 31 2012 // /* Copyright or © or Copr. Bio++ Development Team, (2012) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _SEQUENCESTREAMTOMAFITERATOR_H_ #define _SEQUENCESTREAMTOMAFITERATOR_H_ #include "MafIterator.h" #include #include //From the STL: #include #include namespace bpp { /** * @brief A MafIterator built from a sequence stream. * * Each block will contain one sequence from the original file. * * @author Julien Dutheil */ class SequenceStreamToMafIterator: public AbstractMafIterator { private: std::auto_ptr seqStream_; std::istream* stream_; bool zeroBasedCoords_; bool firstBlock_; public: SequenceStreamToMafIterator(ISequenceStream* seqStream, std::istream* stream, bool parseMask = false, bool zeroBasedCoordinates = true) : seqStream_(seqStream), stream_(stream), zeroBasedCoords_(zeroBasedCoordinates), firstBlock_(true) {} private: //Recopy is forbidden! SequenceStreamToMafIterator(const SequenceStreamToMafIterator& ss2mi): seqStream_(0), stream_(0), zeroBasedCoords_(ss2mi.zeroBasedCoords_), firstBlock_(ss2mi.firstBlock_) {} SequenceStreamToMafIterator& operator=(const SequenceStreamToMafIterator& ss2mi) { seqStream_.reset(); stream_ = 0; zeroBasedCoords_ = ss2mi.zeroBasedCoords_; firstBlock_ = ss2mi.firstBlock_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_SEQUENCESTREAMTOMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafParser.cpp000664 001750 001750 00000013706 12407765466 023404 0ustar00jdutheiljdutheil000000 000000 // // File: MafParser.cpp // Authors: Julien Dutheil // Created: Tue Apr 27 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "MafParser.h" #include #include #include #include using namespace std; using namespace bpp; MafBlock* MafParser::analyseCurrentBlock_() throw (Exception) { MafBlock* block = 0; string line; bool test = true; MafSequence* currentSequence = 0; while (test) { if (stream_->eof()) return 0; getline(*stream_, line, '\n'); if (TextTools::isEmpty(line)) { if (firstBlock_) continue; if (currentSequence) { //Add previous sequence: block->addSequence(*currentSequence); //The sequence is copied in the container. delete currentSequence; } //end of paragraph test = false; } else if (line[0] == 'a') { if (currentSequence) { //Add previous sequence: block->addSequence(*currentSequence); //The sequence is copied in the container. delete currentSequence; } //New block. block = new MafBlock(); firstBlock_ = false; map args; if (line.size() > 2) { KeyvalTools::multipleKeyvals(line.substr(2), args, " "); if (args.find("score") != args.end()) if (args["score"] != "NA") block->setScore(TextTools::toDouble(args["score"])); if (args.find("pass") != args.end()) block->setPass(TextTools::to(args["pass"])); } } else if (line[0] == 's') { StringTokenizer st(line); st.nextToken(); //The 's' tag string src = st.nextToken(); unsigned int start = TextTools::to(st.nextToken()); unsigned int size = TextTools::to(st.nextToken()); string tmp = st.nextToken(); if (tmp.size() != 1) throw Exception("MafAlignmentParser::nextBlock. Strand specification is incorrect, should be only one character long, found " + TextTools::toString(tmp.size()) + "."); char strand = tmp[0]; unsigned int srcSize = TextTools::to(st.nextToken()); if (currentSequence) { //Add previous sequence: block->addSequence(*currentSequence); //The sequence is copied in the container. delete currentSequence; } const string seq = st.nextToken(); currentSequence = new MafSequence(src, seq, start, strand, srcSize); if (currentSequence->getGenomicSize() != size) throw Exception("MafAlignmentParser::nextBlock. Sequence found (" + src + ") does not match specified size: " + TextTools::toString(currentSequence->getGenomicSize()) + ", should be " + TextTools::toString(size) + "."); //Add mask: if (mask_) { vector mask(currentSequence->size()); for (unsigned int i = 0; i < mask.size(); ++i) { mask[i] = cmAlphabet_.isMasked(seq[i]); } currentSequence->addAnnotation(new SequenceMask(mask)); } } else if (line[0] == 'q') { if (!currentSequence) throw Exception("MafAlignmentParser::nextBlock(). Quality scores found, but there is currently no sequence!"); StringTokenizer st(line); st.nextToken(); //The 'q' tag string name = st.nextToken(); if (name != currentSequence->getName()) throw Exception("MafAlignmentParser::nextBlock(). Quality scores found, but with a different name from the previous sequence: " + name + ", should be " + currentSequence->getName() + "."); string qstr = st.nextToken(); //Now parse the score string: SequenceQuality* seqQual = new SequenceQuality(qstr.size()); for (unsigned int i = 0; i < qstr.size(); ++i) { char c = qstr[i]; if (c == '-') { seqQual->setScore(i, -1); } else if (c == '0' || c == '1' || c == '2' || c== '3' || c == '4' || c == '5' || c == '6' || c == '7' || c == '8' || c == '9') { seqQual->setScore(i, c - '0'); } else if (c == 'F' || c == 'f') { //Finished seqQual->setScore(i, 10); } else if (c == '?' || c == '.') { seqQual->setScore(i, -2); } else { throw Exception("MafAlignmentParser::nextBlock(). Unvalid quality score: " + TextTools::toString(c) + ". Should be 0-9, F or '-'."); } } currentSequence->addAnnotation(seqQual); } } return block; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/FeatureFilterMafIterator.cpp000664 001750 001750 00000021273 12407765466 026421 0ustar00jdutheiljdutheil000000 000000 // // File: FeatureFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "FeatureFilterMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* FeatureFilterMafIterator::analyseCurrentBlock_() throw (Exception) { if (blockBuffer_.size() == 0) { //Unless there is no more block in the buffer, we need to parse more: do { MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. //Check if the block contains the reference species: if (!block->hasSequenceForSpecies(refSpecies_)) { if (logstream_) { (*logstream_ << "FEATURE FILTER: block " << block->getDescription() << " does not contain the reference species and was kept as is.").endLine(); } return block; } //Get the feature ranges for this block: const MafSequence& refSeq = block->getSequenceForSpecies(refSpecies_); //first check if there is one (for now we assume that features refer to the chromosome or contig name, with implicit species): std::map >::iterator mr = ranges_.find(refSeq.getChromosome()); if (mr == ranges_.end()) { if (logstream_) { (*logstream_ << "FEATURE FILTER: block " << block->getDescription() << " does not contain any feature and was kept as is.").endLine(); } return block; } //else MultiRange mRange = mr->second; //mRange.restrictTo(Range(refSeq.start(), refSeq.stop() + 1)); jdutheil on 17/04/13: do we really need the +1 here? mRange.restrictTo(refSeq.getRange(true)); if (mRange.isEmpty()) { if (logstream_) { (*logstream_ << "FEATURE FILTER: block " << block->getDescription() << " does not contain any feature and was kept as is.").endLine(); } return block; } std::vector tmp = mRange.getBounds(); //If the reference sequence is on the negative strand, then we have to correct the coordinates: std::deque refBounds; if (refSeq.getStrand() == '-') { for (size_t i = 0; i < tmp.size(); ++i) { refBounds.push_front(refSeq.getSrcSize() - tmp[i]); } } else { refBounds = deque(tmp.begin(), tmp.end()); } //Now extract corresponding alignments. We use the range to split the original block. //Only thing to watch out is the coordinates, refering to the ref species... //A good idea is then to convert those with respect to the given block: int gap = refSeq.getAlphabet()->getGapCharacterCode(); long int refPos = static_cast(refSeq.start()) - 1; //long int refPos = refSeq.getStrand() == '-' ? static_cast(refSeq.getSrcSize() - refSeq.start()) - 1 : static_cast(refSeq.start()) - 1; std::vector pos; if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Removing features", true); } for (size_t alnPos = 0; alnPos < refSeq.size() && refBounds.size() > 0; ++alnPos) { if (verbose_) ApplicationTools::displayGauge(alnPos, refBounds.back(), '>'); if (refSeq[alnPos] != gap) { refPos++; //check if this position is a bound: if (refBounds.front() == static_cast(refPos)) { pos.push_back(alnPos); refBounds.pop_front(); } } } if (verbose_) ApplicationTools::displayTaskDone(); //Check if the last bound matches the end of the alignment: if (refBounds.size() > 0 && refBounds.front() == refSeq.stop()) { pos.push_back(refSeq.size()); refBounds.pop_front(); } if (refBounds.size() > 0) { VectorTools::print(vector(refBounds.begin(), refBounds.end())); throw Exception("FeatureFilterMafIterator::nextBlock(). An error occurred here, " + TextTools::toString(refBounds.size()) + " coordinates are left, in sequence " + refSeq.getDescription() + "... this is most likely a bug, please report!"); } //Next step is simply to split the black according to the translated coordinates: if (pos.size() == 2 && pos.front() == 0 && pos.back() == block->getNumberOfSites()) { //Everything is removed: if (logstream_) { (*logstream_ << "FEATURE FILTER: block " << block->getDescription() << " was entirely removed. Tried to get the next one.").endLine(); } } else { if (logstream_) { (*logstream_ << "FEATURE FILTER: block " << block->getDescription() << " with size "<< block->getNumberOfSites() << " will be split into " << (pos.size() / 2 + 1) << " blocks.").endLine(); } if (verbose_) { ApplicationTools::displayTask("Spliting block", true); } for (size_t i = 0; i < pos.size(); i+=2) { if (verbose_) ApplicationTools::displayGauge(i, pos.size() - 2, '='); if (logstream_) { (*logstream_ << "FEATURE FILTER: removing region (" << pos[i] << ", " << pos[i+1] << ") from block " << block->getDescription() << ".").endLine(); } if (pos[i] > 0) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; if (i == 0) { subseq = block->getSequence(j).subSequence(0, pos[i]); } else { subseq = block->getSequence(j).subSequence(pos[i - 1], pos[i] - pos[i - 1]); } newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (keepTrashedBlocks_) { MafBlock* outBlock = new MafBlock(); outBlock->setScore(block->getScore()); outBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* outseq = block->getSequence(j).subSequence(pos[i], pos[i + 1] - pos[i]); outBlock->addSequence(*outseq); delete outseq; } trashBuffer_.push_back(outBlock); } } //Add last block: if (pos.back() < block->getNumberOfSites()) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; subseq = block->getSequence(j).subSequence(pos[pos.size() - 1], block->getNumberOfSites() - pos[pos.size() - 1]); newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); delete block; } } while (blockBuffer_.size() == 0); } MafBlock* nxtBlock = blockBuffer_.front(); blockBuffer_.pop_front(); return nxtBlock; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafIterator.h000664 001750 001750 00000015340 12372454303 023364 0ustar00jdutheiljdutheil000000 000000 // // File: MafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _MAFITERATOR_H_ #define _MAFITERATOR_H_ #include "MafBlock.h" //From the STL: #include #include #include namespace bpp { //Forward declaration: class IterationListener; /** * @brief Interface to loop over maf alignment blocks. */ class MafIterator { public: virtual ~MafIterator() {} public: /** * @brief Get the next available alignment block. * * @return A maf alignment block, or a null pointer if no more block is available. */ virtual MafBlock* nextBlock() throw (Exception) = 0; virtual bool isVerbose() const = 0; virtual void setVerbose(bool yn) = 0; virtual void addIterationListener(IterationListener* listener) = 0; }; /** * @brief Partial implementation of the MafIterator interface. * * This implements the listener parts. */ class AbstractMafIterator: public virtual MafIterator { protected: std::vector iterationListeners_; bool started_; bool verbose_; public: AbstractMafIterator(): iterationListeners_(), started_(false), verbose_(true) {} virtual ~AbstractMafIterator() {} public: void addIterationListener(IterationListener* listener) { iterationListeners_.push_back(listener); } MafBlock* nextBlock() throw (Exception) { if (!started_) { fireIterationStartSignal_(); started_ = true; } MafBlock* block = analyseCurrentBlock_(); if (block) fireIterationMoveSignal_(*block); else fireIterationStopSignal_(); return block; } bool isVerbose() const { return verbose_; } void setVerbose(bool yn) { verbose_ = yn; } protected: virtual MafBlock* analyseCurrentBlock_() = 0; virtual void fireIterationStartSignal_(); virtual void fireIterationMoveSignal_(const MafBlock& currentBlock); virtual void fireIterationStopSignal_(); }; /** * @brief Interface to loop over removed blocks of a maf alignment. */ class MafTrashIterator { public: virtual ~MafTrashIterator() {} public: /** * @brief Get the next available removed alignment block. * * @return A maf alignment block, or a null pointer if no more block is available. */ virtual MafBlock* nextRemovedBlock() throw (Exception) = 0; }; /** * @brief Helper class for developping filter for maf blocks. */ class AbstractFilterMafIterator: public AbstractMafIterator { protected: MafIterator* iterator_; MafBlock* currentBlock_; OutputStream* logstream_; public: AbstractFilterMafIterator(MafIterator* iterator) : AbstractMafIterator(), iterator_(iterator), currentBlock_(0), logstream_(ApplicationTools::message) {} private: AbstractFilterMafIterator(const AbstractFilterMafIterator& it): AbstractMafIterator(it), iterator_(it.iterator_), currentBlock_(0), logstream_(it.logstream_) {} AbstractFilterMafIterator& operator=(const AbstractFilterMafIterator& it) { AbstractMafIterator::operator=(it); currentBlock_ = 0; iterator_ = it.iterator_; logstream_ = it.logstream_; return *this; } public: void setLogStream(OutputStream* logstream) { logstream_ = logstream; } }; class TrashIteratorAdapter: public AbstractMafIterator { private: MafTrashIterator* iterator_; public: TrashIteratorAdapter(MafTrashIterator* iterator) : iterator_(iterator) {} private: TrashIteratorAdapter(const TrashIteratorAdapter& iterator) : iterator_(iterator.iterator_) {} TrashIteratorAdapter& operator=(const TrashIteratorAdapter& iterator) { iterator_ = iterator.iterator_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception) { return iterator_->nextRemovedBlock(); } }; /** * @brief This special iterator synchronizes two adaptors. * * It takes as input a main iterator and a secondary one. The nextBlock method of the secondary iterator will be * called immediately after the one of the primary one. The resulting block of the main iterator will be forwarded, * while the one of the secondary iterator will be destroyed. */ class MafIteratorSynchronizer: public AbstractFilterMafIterator { private: MafIterator* secondaryIterator_; public: MafIteratorSynchronizer(MafIterator* primaryIterator, MafIterator* secondaryIterator) : AbstractFilterMafIterator(primaryIterator), secondaryIterator_(secondaryIterator) {} private: MafIteratorSynchronizer(const MafIteratorSynchronizer& iterator) : AbstractFilterMafIterator(0), secondaryIterator_(iterator.secondaryIterator_) {} MafIteratorSynchronizer& operator=(const MafIteratorSynchronizer& iterator) { secondaryIterator_ = iterator.secondaryIterator_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); MafBlock* secondBlock = secondaryIterator_->nextBlock(); if (secondBlock) delete secondBlock; return currentBlock_; } }; } // end of namespace bpp. #endif //_MAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MaskFilterMafIterator.h000664 001750 001750 00000006273 12372454303 025353 0ustar00jdutheiljdutheil000000 000000 // // File: MaskFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _MASKFILTERMAFITERATOR_H_ #define _MASKFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to remove regions with masked positions. * * Regions with a too high proportion of masked position in a set of species will be removed, * and blocks adjusted accordingly. */ class MaskFilterMafIterator: public AbstractFilterMafIterator, public MafTrashIterator { private: std::vector species_; unsigned int windowSize_; unsigned int step_; unsigned int maxMasked_; std::deque blockBuffer_; std::deque trashBuffer_; std::deque< std::vector > window_; bool keepTrashedBlocks_; public: MaskFilterMafIterator(MafIterator* iterator, const std::vector& species, unsigned int windowSize, unsigned int step, unsigned int maxMasked, bool keepTrashedBlocks) : AbstractFilterMafIterator(iterator), species_(species), windowSize_(windowSize), step_(step), maxMasked_(maxMasked), blockBuffer_(), trashBuffer_(), window_(species.size()), keepTrashedBlocks_(keepTrashedBlocks) {} public: MafBlock* nextRemovedBlock() throw (Exception) { if (trashBuffer_.size() == 0) return 0; MafBlock* block = trashBuffer_.front(); trashBuffer_.pop_front(); return block; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_MASKFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/FeatureExtractorMafIterator.h000664 001750 001750 00000007301 12372454303 026572 0ustar00jdutheiljdutheil000000 000000 // // File: FeatureExtractorMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _FEATUREEXTRACTORMAFITERATOR_H_ #define _FEATUREEXTRACTORMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Extract alignments corresponding to sequence features given as a vector of SequenceFeature objects. * * The resulting blocks will contain the specified annotated regions. * Note that this iterator is not the opposite of FeatureFilterMafIterator, * as overlapping features will all be extracted. This iterator may therefore results * in duplication of original data. */ class FeatureExtractor: public AbstractFilterMafIterator { private: std::string refSpecies_; bool completeOnly_; bool ignoreStrand_; std::deque blockBuffer_; std::map > ranges_; public: /** * @brief Build a new FeatureExtractor iterator. * * @param iterator The input iterator * @param refSpecies The reference species for feature coordinates * @param complete Tell if features should be extracted only if they can be extracted in full * @param features The set of features to extract * @param ignoreStrand If true, features will be extracted 'as is', without being reversed in case they are on the negative strand. */ FeatureExtractor(MafIterator* iterator, const std::string& refSpecies, const SequenceFeatureSet& features, bool complete = false, bool ignoreStrand = false) : AbstractFilterMafIterator(iterator), refSpecies_(refSpecies), completeOnly_(complete), ignoreStrand_(ignoreStrand), blockBuffer_(), ranges_() { //Build ranges: std::set seqIds = features.getSequences(); for (std::set::iterator it = seqIds.begin(); it != seqIds.end(); ++it) { { features.fillRangeCollectionForSequence(*it, ranges_[*it]); } } } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_FEATUREEXTRACTORMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/AlignmentFilterMafIterator.h000664 001750 001750 00000013247 12372454303 026375 0ustar00jdutheiljdutheil000000 000000 // // File: AlignmentFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _ALIGNMENTFILTERMAFITERATOR_H_ #define _ALIGNMENTFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to remove ambiguously aligned or non-informative regions. * * Regions with a too high proportion of gaps, unknown character or high entropy in a set of species will be removed, * and blocks adjusted accordingly. * * The total entropy of a window is defined as @f$ \frac{\sum_i {E(5)}_i}{w} @f$ where @f$E(5)_i@f$ is the shannon entropy of site i, computed using a logarithm of base 5, and w is the window size. * As a result, the total entropy is normalized so that it falls between 0 and 1. A logarithm of base 5 is used to account for the fact that gaps are considered as a state. * * In case a sequence from the list is missing, it can be either ignored or counted as a full sequence of gaps. */ class AlignmentFilterMafIterator: public AbstractFilterMafIterator, public virtual MafTrashIterator { private: std::vector species_; unsigned int windowSize_; unsigned int step_; unsigned int maxGap_; double maxEnt_; std::deque blockBuffer_; std::deque trashBuffer_; std::deque< std::vector > window_; bool keepTrashedBlocks_; bool missingAsGap_; public: AlignmentFilterMafIterator(MafIterator* iterator, const std::vector& species, unsigned int windowSize, unsigned int step, unsigned int maxGap, double maxEnt, bool keepTrashedBlocks, bool missingAsGap) : AbstractFilterMafIterator(iterator), species_(species), windowSize_(windowSize), step_(step), maxGap_(maxGap), maxEnt_(maxEnt), blockBuffer_(), trashBuffer_(), window_(species.size()), keepTrashedBlocks_(keepTrashedBlocks), missingAsGap_(missingAsGap) {} public: MafBlock* nextRemovedBlock() throw (Exception) { if (trashBuffer_.size() == 0) return 0; MafBlock* block = trashBuffer_.front(); trashBuffer_.pop_front(); return block; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; /** * @brief Filter maf blocks to remove ambiguously aligned or non-informative regions. * * This iterators offers a different algorithm than AlignmentFilterMafIterator. * It takes two parameters: g=maxGap and n=maxPos. Windows with more than n positions containing each of them more than g=maxPos gaps will be discarded. * In addition, consecutives patterns are only counted once. * In case a sequence from the list is missing, it can be either ignored or counted as a full sequence of gaps. */ class AlignmentFilter2MafIterator: public AbstractFilterMafIterator, public virtual MafTrashIterator { private: std::vector species_; unsigned int windowSize_; unsigned int step_; unsigned int maxGap_; unsigned int maxPos_; std::deque blockBuffer_; std::deque trashBuffer_; std::deque< std::vector > window_; bool keepTrashedBlocks_; bool missingAsGap_; public: AlignmentFilter2MafIterator(MafIterator* iterator, const std::vector& species, unsigned int windowSize, unsigned int step, unsigned int maxGap, unsigned int maxPos, bool keepTrashedBlocks, bool missingAsGap) : AbstractFilterMafIterator(iterator), species_(species), windowSize_(windowSize), step_(step), maxGap_(maxGap), maxPos_(maxPos), blockBuffer_(), trashBuffer_(), window_(species.size()), keepTrashedBlocks_(keepTrashedBlocks), missingAsGap_(missingAsGap) {} public: MafBlock* nextRemovedBlock() throw (Exception) { if (trashBuffer_.size() == 0) return 0; MafBlock* block = trashBuffer_.front(); trashBuffer_.pop_front(); return block; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_ALIGNMENTFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafParser.h000664 001750 001750 00000005533 12372454303 023032 0ustar00jdutheiljdutheil000000 000000 // // File: MafParser.h // Authors: Julien Dutheil // Created: Tue Apr 27 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _MAFPARSER_H_ #define _MAFPARSER_H_ #include "MafIterator.h" #include //From the STL: #include namespace bpp { /** * @brief MAF file parser. * * This class parses synteny blocks from Maf file. * * The MAF format is documented on the UCSC Genome Browser website: * http://genome.ucsc.edu/FAQ/FAQformat.html#format5 * * @author Julien Dutheil */ class MafParser: public AbstractMafIterator { private: std::istream* stream_; bool mask_; CaseMaskedAlphabet cmAlphabet_; bool firstBlock_; public: MafParser(std::istream* stream, bool parseMask = false) : stream_(stream), mask_(parseMask), cmAlphabet_(&AlphabetTools::DNA_ALPHABET), firstBlock_(true) {} private: //Recopy is forbidden! MafParser(const MafParser& maf): stream_(0), mask_(maf.mask_), cmAlphabet_(&AlphabetTools::DNA_ALPHABET), firstBlock_(maf.firstBlock_) {} MafParser& operator=(const MafParser& maf) { stream_ = 0; mask_ = maf.mask_; firstBlock_ = maf.firstBlock_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_MAFPARSER_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/OutputMafIterator.h000664 001750 001750 00000005764 12372454303 024616 0ustar00jdutheiljdutheil000000 000000 // // File: OutputMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _OUTPUTMAFITERATOR_H_ #define _OUTPUTMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief This iterator forward the iterator given as input after having printed its content to a file. */ class OutputMafIterator: public AbstractFilterMafIterator { private: std::ostream* output_; bool mask_; public: OutputMafIterator(MafIterator* iterator, std::ostream* out, bool mask = true) : AbstractFilterMafIterator(iterator), output_(out), mask_(mask) { if (output_) writeHeader(*output_); } private: OutputMafIterator(const OutputMafIterator& iterator) : AbstractFilterMafIterator(0), output_(iterator.output_), mask_(iterator.mask_) {} OutputMafIterator& operator=(const OutputMafIterator& iterator) { output_ = iterator.output_; mask_ = iterator.mask_; return *this; } public: MafBlock* analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); if (output_ && currentBlock_) writeBlock(*output_, *currentBlock_); return currentBlock_; } private: void writeHeader(std::ostream& out) const; void writeBlock(std::ostream& out, const MafBlock& block) const; }; } // end of namespace bpp. #endif //_OUTPUTMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/EntropyFilterMafIterator.h000664 001750 001750 00000007074 12372454303 026120 0ustar00jdutheiljdutheil000000 000000 // // File: EntropyMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _ENTROPYFILTERMAFITERATOR_H_ #define _ENTROPYFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks highly divergent regions. * * This iterators takes two parameters: g=maxEnt and n=maxPos. Windows with more than n positions with a entropy higher than maxEnt will be discarded. * In addition, consecutives patterns are only counted once. * In case a sequence from the list is missing, it can be either ignored or counted as a full sequence of gaps. */ class EntropyFilterMafIterator: public AbstractFilterMafIterator, public virtual MafTrashIterator { private: std::vector species_; unsigned int windowSize_; unsigned int step_; double maxEnt_; unsigned int maxPos_; std::deque blockBuffer_; std::deque trashBuffer_; std::deque window_; bool keepTrashedBlocks_; bool missingAsGap_; bool ignoreGaps_; public: EntropyFilterMafIterator(MafIterator* iterator, const std::vector& species, unsigned int windowSize, unsigned int step, double maxEnt, unsigned int maxPos, bool keepTrashedBlocks, bool missingAsGap, bool ignoreGaps) : AbstractFilterMafIterator(iterator), species_(species), windowSize_(windowSize), step_(step), maxEnt_(maxEnt), maxPos_(maxPos), blockBuffer_(), trashBuffer_(), window_(species.size()), keepTrashedBlocks_(keepTrashedBlocks), missingAsGap_(missingAsGap), ignoreGaps_(ignoreGaps) {} public: MafBlock* nextRemovedBlock() throw (Exception) { if (trashBuffer_.size() == 0) return 0; MafBlock* block = trashBuffer_.front(); trashBuffer_.pop_front(); return block; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_ENTROPYFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/DuplicateFilterMafIterator.h000664 001750 001750 00000006006 12372454303 026364 0ustar00jdutheiljdutheil000000 000000 // // File: DuplicateFilterMafIterator.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _DUPLICATEFILTERMAFITERATOR_H_ #define _DUPLICATEFILTERMAFITERATOR_H_ #include "MafIterator.h" //From the STL: #include #include #include namespace bpp { /** * @brief Filter maf blocks to remove duplicated blocks, according to a reference sequence). */ class DuplicateFilterMafIterator: public AbstractFilterMafIterator { private: std::string ref_; /** * Contains the list of 'seen' block, as [chr][strand][start][stop] */ std::map< std::string, std::map< char, std::map< size_t, std::map< size_t, size_t > > > > blocks_; public: /** * @param iterator The input iterator. * @param reference The reference species name. */ DuplicateFilterMafIterator(MafIterator* iterator, const std::string& reference) : AbstractFilterMafIterator(iterator), ref_(reference), blocks_() {} private: DuplicateFilterMafIterator(const DuplicateFilterMafIterator& iterator) : AbstractFilterMafIterator(0), ref_(iterator.ref_), blocks_(iterator.blocks_) {} DuplicateFilterMafIterator& operator=(const DuplicateFilterMafIterator& iterator) { ref_ = iterator.ref_; blocks_ = iterator.blocks_; return *this; } private: MafBlock* analyseCurrentBlock_() throw (Exception); }; } // end of namespace bpp. #endif //_DUPLICATEFILTERMAFITERATOR_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafBlock.h000664 001750 001750 00000021305 12372454303 022623 0ustar00jdutheiljdutheil000000 000000 // // File: MafBlock.h // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _MAFBLOCK_H_ #define _MAFBLOCK_H_ #include "MafSequence.h" #include #include namespace bpp { /** * @brief A synteny block data structure, the basic unit of a MAF alignement file. * * This class basically contains a AlignedSequenceContainer made of MafSequence objects. */ class MafBlock: public virtual Clonable { private: double score_; unsigned int pass_; AlignedSequenceContainer alignment_; std::map properties_; public: MafBlock() : score_(log(0)), pass_(0), alignment_(&AlphabetTools::DNA_ALPHABET), properties_() {} MafBlock(const MafBlock& block): score_(block.score_), pass_(block.pass_), alignment_(block.alignment_), properties_() { std::map::const_iterator it; for (it = block.properties_.begin(); it != block.properties_.end(); ++it) { properties_[it->first] = it->second->clone(); } } MafBlock& operator=(const MafBlock& block) { score_ = block.score_; pass_ = block.pass_; alignment_ = block.alignment_; deleteProperties_(); std::map::const_iterator it; for (it = block.properties_.begin(); it != block.properties_.end(); ++it) { properties_[it->first] = it->second->clone(); } return *this; } MafBlock* clone() const { return new MafBlock(*this); } virtual ~MafBlock() { deleteProperties_(); } public: void setScore(double score) { score_ = score; } void setPass(unsigned int pass) { pass_ = pass; } double getScore() const { return score_; } unsigned int getPass() const { return pass_; } AlignedSequenceContainer& getAlignment() { return alignment_; } const AlignedSequenceContainer& getAlignment() const { return alignment_; } size_t getNumberOfSequences() const { return alignment_.getNumberOfSequences(); } size_t getNumberOfSites() const { return alignment_.getNumberOfSites(); } void addSequence(const MafSequence& sequence) { alignment_.addSequence(sequence, false); } bool hasSequence(const std::string& name) const { return getAlignment().hasSequence(name); } const MafSequence& getSequence(const std::string& name) const throw (SequenceNotFoundException) { return dynamic_cast(getAlignment().getSequence(name)); } const MafSequence& getSequence(size_t i) const throw (IndexOutOfBoundsException) { return dynamic_cast(getAlignment().getSequence(i)); } bool hasSequenceForSpecies(const std::string& species) const { for (size_t i = 0; i < getNumberOfSequences(); ++i) { const MafSequence& seq = getSequence(i); if (seq.getSpecies() == species) return true; } return false; } //Return the first sequence with the species name. const MafSequence& getSequenceForSpecies(const std::string& species) const throw (SequenceNotFoundException) { for (size_t i = 0; i < getNumberOfSequences(); ++i) { const MafSequence& seq = getSequence(i); if (seq.getSpecies() == species) return seq; } throw SequenceNotFoundException("MafBlock::getSequenceForSpecies. No sequence with the given species name in this block.", species); } //Return all sequences with the species name. std::vector getSequencesForSpecies(const std::string& species) const throw (SequenceNotFoundException) { std::vector selection; for (size_t i = 0; i < getNumberOfSequences(); ++i) { const MafSequence* seq = &getSequence(i); if (seq->getSpecies() == species) selection.push_back(seq); } return selection; } /** * @return The species names for all sequencies in the container. */ std::vector getSpeciesList() const { std::vector lst; for (size_t i = 0; i < getNumberOfSequences(); ++i) { lst.push_back(getSequence(i).getSpecies()); } return lst; } void removeCoordinatesFromSequence(size_t i) throw (IndexOutOfBoundsException) { //This is a bit of a trick, but avoid useless recopies. //It is safe here because the AlignedSequenceContainer is fully encapsulated. //It would not work if a VectorSiteContainer was used. const_cast(getSequence(i)).removeCoordinates(); } std::string getDescription() const { std::string desc; desc += TextTools::toString(getNumberOfSequences()) + "x" + TextTools::toString(getNumberOfSites()); return desc; } /** * @return True or False, if data are associated to the given property. * @param property The name of the property to look for. */ bool hasProperty(const std::string& property) const { std::map::const_iterator it = properties_.find(property); return it != properties_.end(); } /** * @brief Get the data associated to a query property. * * @param property The property to look for. * @return The data associated to the given property. * @throw Exception if no data is associated to the given property. */ const Clonable& getProperty(const std::string& property) const throw (Exception) { std::map::const_iterator it = properties_.find(property); if (it == properties_.end()) throw Exception("MafBlock::getProperty. No data for property: " + property + " in block."); return *it->second; } /** * @brief Delete the data associated to a query property. * * @param property The property to look for. * @throw Exception if no data is associated to the given property. */ void deleteProperty(const std::string& property) throw (Exception) { std::map::iterator it = properties_.find(property); if (it == properties_.end()) throw Exception("MafBlock::deleteProperty. No data for property: " + property + " in block."); delete it->second; properties_.erase(it); } /** * @brief Set the data associated to a query property. * * An existing data associated to this property will be deleted and replaced by the new one. * @param property The property to look for. * @param data The data to associate to this property. * @throw Exception if the pointer toward the input data is NULL. */ void setProperty(const std::string& property, Clonable* data) throw (Exception) { if (!data) throw Exception("MafBlock::setProperty. Pointer to data is NULL."); if (hasProperty(property)) deleteProperty(property); properties_[property] = data; } private: void deleteProperties_() { std::map::iterator it; for (it = properties_.begin(); it != properties_.end(); ++it) { delete it->second; } properties_.clear(); } }; } // end of namespace bpp. #endif //_MAFBLOCK_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/ChromosomeMafIterator.cpp000664 001750 001750 00000005423 12372454303 025754 0ustar00jdutheiljdutheil000000 000000 // // File: ChromosomeMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "ChromosomeMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* ChromosomeMafIterator::analyseCurrentBlock_() throw (Exception) { currentBlock_ = iterator_->nextBlock(); while (currentBlock_) { bool foundRef = false; string chr = ""; for (size_t i = 0; i < currentBlock_->getNumberOfSequences() && !foundRef; ++i) { string species = currentBlock_->getSequence(i).getSpecies(); if (species == ref_) { foundRef = true; chr = currentBlock_->getSequence(i).getChromosome(); } } if (!foundRef) { if (logstream_) { (*logstream_ << "CHROMOSOME FILTER: block does not contain reference species and was removed.").endLine(); } delete currentBlock_; } else if (chr != chr_) { if (logstream_) { (*logstream_ << "CHROMOSOME FILTER: reference species without queried chromosome was removed.").endLine(); } delete currentBlock_; } else { return currentBlock_; } //Look for the next block: currentBlock_ = iterator_->nextBlock(); } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MaskFilterMafIterator.cpp000664 001750 001750 00000017700 12372454303 025703 0ustar00jdutheiljdutheil000000 000000 // // File: MaskFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "MaskFilterMafIterator.h" //Fomr bpp-seq: #include using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* MaskFilterMafIterator::analyseCurrentBlock_() throw (Exception) { if (blockBuffer_.size() == 0) { do { //Else there is no more block in the buffer, we need parse more: MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. //Parse block. vector< vector > aln; for (size_t i = 0; i < species_.size(); ++i) { const MafSequence* seq = &block->getSequenceForSpecies(species_[i]); if (seq->hasAnnotation(SequenceMask::MASK)) { aln.push_back(dynamic_cast(seq->getAnnotation(SequenceMask::MASK)).getMask()); } } size_t nr = aln.size(); size_t nc = block->getNumberOfSites(); //First we create a mask: vector pos; vector col(nr); //Reset window: window_.clear(); //Init window: size_t i; for (i = 0; i < windowSize_; ++i) { for (size_t j = 0; j < nr; ++j) { col[j] = aln[j][i]; } window_.push_back(col); } //Slide window: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Sliding window for mask filter", true); } while (i + step_ < nc) { if (verbose_) ApplicationTools::displayGauge(i - windowSize_, nc - windowSize_ - 1, '>'); //Evaluate current window: unsigned int sum = 0; for (size_t u = 0; u < window_.size(); ++u) for (size_t v = 0; v < window_[u].size(); ++v) if (window_[u][v]) sum++; if (sum > maxMasked_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ <= pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } //Move forward: for (size_t k = 0; k < step_; ++k) { for (size_t j = 0; j < nr; ++j) { col[j] = aln[j][i]; } window_.push_back(col); window_.pop_front(); ++i; } } //Evaluate last window: unsigned int sum = 0; for (size_t u = 0; u < window_.size(); ++u) for (size_t v = 0; v < window_[u].size(); ++v) if (window_[u][v]) sum++; if (sum > maxMasked_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ < pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } if (verbose_) ApplicationTools::displayTaskDone(); //Now we remove regions with two many gaps, using a sliding window: if (pos.size() == 0) { blockBuffer_.push_back(block); if (logstream_) { (*logstream_ << "MASK CLEANER: block is clean and kept as is.").endLine(); } } else if (pos.size() == 2 && pos.front() == 0 && pos.back() == block->getNumberOfSites()) { //Everything is removed: if (logstream_) { (*logstream_ << "MASK CLEANER: block was entirely removed. Tried to get the next one.").endLine(); } } else { if (logstream_) { (*logstream_ << "MASK CLEANER: block with size "<< block->getNumberOfSites() << " will be split into " << (pos.size() / 2 + 1) << " blocks.").endLine(); } if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Spliting block", true); } for (i = 0; i < pos.size(); i+=2) { if (verbose_) ApplicationTools::displayGauge(i, pos.size() - 2, '='); if (logstream_) { (*logstream_ << "MASK CLEANER: removing region (" << pos[i] << ", " << pos[i+1] << ") from block.").endLine(); } if (pos[i] > 0) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; if (i == 0) { subseq = block->getSequence(j).subSequence(0, pos[i]); } else { subseq = block->getSequence(j).subSequence(pos[i - 1], pos[i] - pos[i - 1]); } newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (keepTrashedBlocks_) { MafBlock* outBlock = new MafBlock(); outBlock->setScore(block->getScore()); outBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* outseq = block->getSequence(j).subSequence(pos[i], pos[i + 1] - pos[i]); outBlock->addSequence(*outseq); delete outseq; } trashBuffer_.push_back(outBlock); } } //Add last block: if (pos[pos.size() - 1] < block->getNumberOfSites()) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; subseq = block->getSequence(j).subSequence(pos[pos.size() - 1], block->getNumberOfSites() - pos[pos.size() - 1]); newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); delete block; } } while (blockBuffer_.size() == 0); } MafBlock* block = blockBuffer_.front(); blockBuffer_.pop_front(); return block; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/BlockMergerMafIterator.cpp000664 001750 001750 00000015716 12407765466 026061 0ustar00jdutheiljdutheil000000 000000 // // File: BlockMergerMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "BlockMergerMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* BlockMergerMafIterator::analyseCurrentBlock_() throw (Exception) { if (!incomingBlock_) return 0; currentBlock_ = incomingBlock_; incomingBlock_ = iterator_->nextBlock(); while (incomingBlock_) { size_t globalSpace = 0; for (size_t i = 0; i < species_.size(); ++i) { try { const MafSequence* seq1 = ¤tBlock_->getSequenceForSpecies(species_[i]); const MafSequence* seq2 = &incomingBlock_->getSequenceForSpecies(species_[i]); if (!seq1->hasCoordinates() || !seq2->hasCoordinates()) throw Exception("BlockMergerMafIterator::nextBlock. Species '" + species_[i] + "' is missing coordinates in at least one block."); if (seq1->stop() > seq2->start()) return currentBlock_; size_t space = seq2->start() - seq1->stop(); if (space > maxDist_) return currentBlock_; if (i == 0) globalSpace = space; else { if (space != globalSpace) return currentBlock_; } if (seq1->getChromosome() != seq2->getChromosome() || VectorTools::contains(ignoreChrs_, seq1->getChromosome()) || VectorTools::contains(ignoreChrs_, seq2->getChromosome()) || seq1->getStrand() != seq2->getStrand() || seq1->getSrcSize() != seq2->getSrcSize()) { //There is a syntheny break in this sequence, so we do not merge the blocks. return currentBlock_; } } catch (SequenceNotFoundException& snfe) { //At least one block does not contain the sequence. //We don't merge the blocks: return currentBlock_; } } //We merge the two blocks: if (logstream_) { (*logstream_ << "BLOCK MERGER: merging two consecutive blocks.").endLine(); } vector sp1 = currentBlock_->getSpeciesList(); vector sp2 = incomingBlock_->getSpeciesList(); vector allSp = VectorTools::unique(VectorTools::vectorUnion(sp1, sp2)); //We need to create a new MafBlock: MafBlock* mergedBlock = new MafBlock(); //We average the score and pass values: unsigned int p1 = currentBlock_->getPass(); unsigned int p2 = incomingBlock_->getPass(); if (p1 == p2) mergedBlock->setPass(p1); double s1 = currentBlock_->getScore(); double n1 = static_cast(currentBlock_->getNumberOfSites()); double s2 = incomingBlock_->getScore(); double n2 = static_cast(incomingBlock_->getNumberOfSites()); mergedBlock->setScore((s1 * n1 + s2 * n2) / (n1 + n2)); //Now fill the new block: for (size_t i = 0; i < allSp.size(); ++i) { auto_ptr seq; try { seq.reset(new MafSequence(currentBlock_->getSequenceForSpecies(allSp[i]))); //Check is there is a second sequence: try { auto_ptr tmp(new MafSequence(incomingBlock_->getSequenceForSpecies(allSp[i]))); string ref1 = seq->getDescription(), ref2 = tmp->getDescription(); //Add spacer if needed: if (globalSpace > 0) { if (logstream_) { (*logstream_ << "BLOCK MERGER: a spacer of size " << globalSpace <<" is inserted in sequence for species " << allSp[i] << ".").endLine(); } seq->append(vector(globalSpace, AlphabetTools::DNA_ALPHABET.getUnknownCharacterCode())); } if (seq->getChromosome() != tmp->getChromosome()) { seq->setChromosome(seq->getChromosome() + "-" + tmp->getChromosome()); seq->removeCoordinates(); } if (seq->getStrand() != tmp->getStrand()) { seq->setStrand('?'); seq->removeCoordinates(); } if (seq->getName() != tmp->getName()) tmp->setName(seq->getName()); //force name conversion to prevent exception in 'merge'. seq->merge(*tmp); if (logstream_) { (*logstream_ << "BLOCK MERGER: merging " << ref1 << " with " << ref2 << " into " << seq->getDescription()).endLine(); } } catch (SequenceNotFoundException& snfe2) { //There was a first sequence, we just extend it: string ref1 = seq->getDescription(); seq->setToSizeR(seq->size() + incomingBlock_->getNumberOfSites() + globalSpace); if (logstream_) { (*logstream_ << "BLOCK MERGER: extending " << ref1 << " with " << incomingBlock_->getNumberOfSites() << " gaps on the right.").endLine(); } } } catch (SequenceNotFoundException& snfe1) { //There must be a second sequence then: seq.reset(new MafSequence(incomingBlock_->getSequenceForSpecies(allSp[i]))); string ref2 = seq->getDescription(); seq->setToSizeL(seq->size() + currentBlock_->getNumberOfSites() + globalSpace); if (logstream_) { (*logstream_ << "BLOCK MERGER: adding " << ref2 << " and extend it with " << currentBlock_->getNumberOfSites() << " gaps on the left.").endLine(); } } mergedBlock->addSequence(*seq); } //Cleaning stuff: delete currentBlock_; delete incomingBlock_; currentBlock_ = mergedBlock; //We check if we can also merge the next block: incomingBlock_ = iterator_->nextBlock(); } return currentBlock_; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/AlignmentFilterMafIterator.cpp000664 001750 001750 00000041476 12372454303 026735 0ustar00jdutheiljdutheil000000 000000 // // File: AlignmentFilterMafIterator.cpp // Authors: Julien Dutheil // Created: Tue Sep 07 2010 // /* Copyright or © or Copr. Bio++ Development Team, (2010) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "AlignmentFilterMafIterator.h" using namespace bpp; //From the STL: #include #include using namespace std; MafBlock* AlignmentFilterMafIterator::analyseCurrentBlock_() throw (Exception) { if (blockBuffer_.size() == 0) { //Else there is no more block in the buffer, we need to parse more: do { MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. //Parse block. int gap = AlphabetTools::DNA_ALPHABET.getGapCharacterCode(); int unk = AlphabetTools::DNA_ALPHABET.getUnknownCharacterCode(); size_t nr; size_t nc = static_cast(block->getNumberOfSites()); vector< vector > aln; if (missingAsGap_) { nr = species_.size(); aln.resize(nr); for (size_t i = 0; i < nr; ++i) { if (block->hasSequenceForSpecies(species_[i])) aln[i] = block->getSequenceForSpecies(species_[i]).getContent(); else { aln[i].resize(nc); fill(aln[i].begin(), aln[i].end(), gap); } } } else { vector speciesSet = VectorTools::vectorIntersection(species_, block->getSpeciesList()); nr = speciesSet.size(); aln.resize(nr); for (size_t i = 0; i < nr; ++i) { aln[i] = block->getSequenceForSpecies(species_[i]).getContent(); } } //First we create a mask: vector pos; vector col(nr); //Reset window: window_.clear(); //Init window: size_t i; if (nc < windowSize_) throw Exception("AlignmentFilterMafIterator::analyseCurrentBlock_. Block is smaller than window size: " + TextTools::toString(nc)); for (i = 0; i < windowSize_; ++i) { for (size_t j = 0; j < nr; ++j) { col[j] = aln[j][i]; } window_.push_back(col); } //Slide window: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Sliding window for alignment filter", true); } while (i + step_ < nc) { if (verbose_) ApplicationTools::displayGauge(i - windowSize_, nc - windowSize_ - 1, '>'); //Evaluate current window: unsigned int sumGap = 0; double sumEnt = 0; for (size_t u = 0; u < window_.size(); ++u) { for (size_t v = 0; v < window_[u].size(); ++v) { if (window_[u][v] == gap || window_[u][v] == unk) { sumGap++; } col[v] = window_[u][v]; if (col[v] == unk) col[v] = gap; } sumEnt += VectorTools::shannonDiscrete(col) / log(5.); } if (sumGap > maxGap_ && (sumEnt / static_cast(windowSize_)) > maxEnt_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ < pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } //Move forward: for (size_t k = 0; k < step_; ++k) { for (size_t j = 0; j < nr; ++j) { col[j] = aln[j][i]; } window_.push_back(col); window_.pop_front(); ++i; } } //Evaluate last window: unsigned int sumGap = 0; double sumEnt = 0; for (size_t u = 0; u < window_.size(); ++u) { for (size_t v = 0; v < window_[u].size(); ++v) { if (window_[u][v] == gap || window_[u][v] == unk) { sumGap++; } col[v] = window_[u][v]; if (col[v] == unk) col[v] = gap; } sumEnt += VectorTools::shannonDiscrete(col) / log(5.); } if (sumGap > maxGap_ && (sumEnt / static_cast(windowSize_)) > maxEnt_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ <= pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } if (verbose_) ApplicationTools::displayTaskDone(); //Now we remove regions with two many gaps, using a sliding window: if (pos.size() == 0) { blockBuffer_.push_back(block); if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " is clean and kept as is.").endLine(); } } else if (pos.size() == 2 && pos.front() == 0 && pos.back() == block->getNumberOfSites()) { //Everything is removed: if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " was entirely removed. Tried to get the next one.").endLine(); } } else { if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " with size "<< block->getNumberOfSites() << " will be split into " << (pos.size() / 2 + 1) << " blocks.").endLine(); } if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Spliting block", true); } for (i = 0; i < pos.size(); i+=2) { if (verbose_) ApplicationTools::displayGauge(i, pos.size() - 2, '='); if (logstream_) { (*logstream_ << "ALN CLEANER: removing region (" << pos[i] << ", " << pos[i+1] << ") from block " << block->getDescription() << ".").endLine(); } if (pos[i] > 0) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; if (i == 0) { subseq = block->getSequence(j).subSequence(0, pos[i]); } else { subseq = block->getSequence(j).subSequence(pos[i - 1], pos[i] - pos[i - 1]); } newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (keepTrashedBlocks_) { MafBlock* outBlock = new MafBlock(); outBlock->setScore(block->getScore()); outBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* outseq = block->getSequence(j).subSequence(pos[i], pos[i + 1] - pos[i]); outBlock->addSequence(*outseq); delete outseq; } trashBuffer_.push_back(outBlock); } } //Add last block: if (pos[pos.size() - 1] < block->getNumberOfSites()) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; subseq = block->getSequence(j).subSequence(pos[pos.size() - 1], block->getNumberOfSites() - pos[pos.size() - 1]); newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); delete block; } } while (blockBuffer_.size() == 0); } MafBlock* block = blockBuffer_.front(); blockBuffer_.pop_front(); return block; } MafBlock* AlignmentFilter2MafIterator::analyseCurrentBlock_() throw (Exception) { if (blockBuffer_.size() == 0) { //Else there is no more block in the buffer, we need to parse more: do { MafBlock* block = iterator_->nextBlock(); if (!block) return 0; //No more block. //Parse block. int gap = AlphabetTools::DNA_ALPHABET.getGapCharacterCode(); int unk = AlphabetTools::DNA_ALPHABET.getUnknownCharacterCode(); size_t nr; size_t nc = static_cast(block->getNumberOfSites()); vector< vector > aln; if (missingAsGap_) { nr = species_.size(); aln.resize(nr); for (size_t i = 0; i < nr; ++i) { if (block->hasSequenceForSpecies(species_[i])) aln[i] = block->getSequenceForSpecies(species_[i]).getContent(); else { aln[i].resize(nc); fill(aln[i].begin(), aln[i].end(), gap); } } } else { vector speciesSet = VectorTools::vectorIntersection(species_, block->getSpeciesList()); nr = speciesSet.size(); aln.resize(nr); for (size_t i = 0; i < nr; ++i) { aln[i] = block->getSequenceForSpecies(species_[i]).getContent(); } } //First we create a mask: vector pos; vector col(nr); //Reset window: window_.clear(); //Init window: size_t i; for (i = 0; i < windowSize_; ++i) { for (size_t j = 0; j < nr; ++j) { col[j] = (aln[j][i] == gap || aln[j][i] == unk); } window_.push_back(col); } //Slide window: if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Sliding window for alignment filter", true); } while (i + step_ < nc) { if (verbose_) ApplicationTools::displayGauge(i - windowSize_, nc - windowSize_ - 1, '>'); //Evaluate current window: unsigned int count = 0; bool posIsGap = true; for (size_t u = 0; u < window_.size(); ++u) { unsigned int partialCount = 0; if (!posIsGap || (u > 0 && window_[u] != window_[u - 1])) { for (size_t v = 0; v < window_[u].size(); ++v) if (window_[u][v]) partialCount++; if (partialCount > maxGap_) { count++; posIsGap = true; } else { posIsGap = false; } } } if (count > maxPos_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ < pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } //Move forward: for (size_t k = 0; k < step_; ++k) { for (size_t j = 0; j < nr; ++j) { col[j] = (aln[j][i] == gap || aln[j][i] == unk); } window_.push_back(col); window_.pop_front(); ++i; } } //Evaluate last window: unsigned int count = 0; bool posIsGap = true; for (size_t u = 0; u < window_.size(); ++u) { unsigned int partialCount = 0; if (!posIsGap || (u > 0 && window_[u] != window_[u - 1])) { for (size_t v = 0; v < window_[u].size(); ++v) if (window_[u][v]) partialCount++; if (partialCount > maxGap_) { count++; posIsGap = true; } else { posIsGap = false; } } } if (count > maxPos_) { if (pos.size() == 0) { pos.push_back(i - windowSize_); pos.push_back(i); } else { if (i - windowSize_ <= pos[pos.size() - 1]) { pos[pos.size() - 1] = i; //Windows are overlapping and we extend previous region } else { //This is a new region pos.push_back(i - windowSize_); pos.push_back(i); } } } if (verbose_) ApplicationTools::displayTaskDone(); //Now we remove regions with two many gaps, using a sliding window: if (pos.size() == 0) { blockBuffer_.push_back(block); if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " is clean and kept as is.").endLine(); } } else if (pos.size() == 2 && pos.front() == 0 && pos.back() == block->getNumberOfSites()) { //Everything is removed: if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " was entirely removed. Tried to get the next one.").endLine(); } } else { if (logstream_) { (*logstream_ << "ALN CLEANER: block " << block->getDescription() << " with size "<< block->getNumberOfSites() << " will be split into " << (pos.size() / 2 + 1) << " blocks.").endLine(); } if (verbose_) { ApplicationTools::message->endLine(); ApplicationTools::displayTask("Spliting block", true); } for (i = 0; i < pos.size(); i+=2) { if (verbose_) ApplicationTools::displayGauge(i, pos.size() - 2, '='); if (logstream_) { (*logstream_ << "ALN CLEANER: removing region (" << pos[i] << ", " << pos[i+1] << ") from block " << block->getDescription() << ".").endLine(); } if (pos[i] > 0) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; if (i == 0) { subseq = block->getSequence(j).subSequence(0, pos[i]); } else { subseq = block->getSequence(j).subSequence(pos[i - 1], pos[i] - pos[i - 1]); } newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (keepTrashedBlocks_) { MafBlock* outBlock = new MafBlock(); outBlock->setScore(block->getScore()); outBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* outseq = block->getSequence(j).subSequence(pos[i], pos[i + 1] - pos[i]); outBlock->addSequence(*outseq); delete outseq; } trashBuffer_.push_back(outBlock); } } //Add last block: if (pos[pos.size() - 1] < block->getNumberOfSites()) { MafBlock* newBlock = new MafBlock(); newBlock->setScore(block->getScore()); newBlock->setPass(block->getPass()); for (size_t j = 0; j < block->getNumberOfSequences(); ++j) { MafSequence* subseq; subseq = block->getSequence(j).subSequence(pos[pos.size() - 1], block->getNumberOfSites() - pos[pos.size() - 1]); newBlock->addSequence(*subseq); delete subseq; } blockBuffer_.push_back(newBlock); } if (verbose_) ApplicationTools::displayTaskDone(); delete block; } } while (blockBuffer_.size() == 0); } MafBlock* block = blockBuffer_.front(); blockBuffer_.pop_front(); return block; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Maf/MafStatistics.h000664 001750 001750 00000052372 12407765466 023751 0ustar00jdutheiljdutheil000000 000000 // // File: MafStatistics.h // Authors: Julien Dutheil // Created: Mon Jun 25 2012 // /* Copyright or © or Copr. Bio++ Development Team, (2012) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _MAFSTATISTICS_H_ #define _MAFSTATISTICS_H_ #include "MafBlock.h" //From bpp-core: #include #include #include //From the STL: #include #include namespace bpp { /** * @brief General interface for storing statistical results. * * @author Julien Dutheil * @see MafStatistics */ class MafStatisticsResult { protected: mutable std::map values_; public: MafStatisticsResult(): values_() {} virtual ~MafStatisticsResult() {} MafStatisticsResult(const MafStatisticsResult& msr): values_() { for (std::map::const_iterator it = msr.values_.begin(); it != msr.values_.end(); ++it) { values_[it->first] = it->second->clone(); } } public: virtual const BppNumberI& getValue(const std::string& tag) const throw (Exception) { std::map::iterator it = values_.find(tag); if (it != values_.end()) return *it->second; else throw Exception("MafStatisticsResult::getValue(). No value found for tag: " + tag + "."); } /** * @brief Associate a value to a certain tag. Any existing tag will be overwritten * * @param tag The name of the value to associate. * @param value The value to associate to the tag. */ virtual void setValue(const std::string& tag, double value) throw (Exception) { if (values_[tag]) { delete values_[tag]; } values_[tag] = new BppDouble(value); } /** * @brief Associate a value to a certain tag. Any existing tag will be overwritten * * @param tag The name of the value to associate. * @param value The value to associate to the tag. */ virtual void setValue(const std::string& tag, int value) throw (Exception) { if (values_[tag]) { delete values_[tag]; } values_[tag] = new BppInteger(value); } /** * @brief Associate a value to a certain tag. Any existing tag will be overwritten * * @param tag The name of the value to associate. * @param value The value to associate to the tag. */ virtual void setValue(const std::string& tag, unsigned int value) throw (Exception) { if (values_[tag]) { delete values_[tag]; } values_[tag] = new BppUnsignedInteger(value); } /** * @return A boolean saying whether a value is available for the given tag. * @param tag The name of the value to associate. */ virtual bool hasValue(const std::string& tag) const { return (values_.find(tag) != values_.end()); } /** * @return A vector with all available tags. */ std::vector getAvailableTags() const { return MapTools::getKeys(values_); } }; /** * @brief A simple maf statistics result, with only one value. */ class SimpleMafStatisticsResult: public virtual MafStatisticsResult { private: std::string name_; public: SimpleMafStatisticsResult(const std::string& name): MafStatisticsResult(), name_(name) { setValue(name, 0); } virtual ~SimpleMafStatisticsResult() {} public: virtual const BppNumberI& getValue(const std::string& tag) const throw (Exception) { return SimpleMafStatisticsResult::getValue(tag); } virtual const BppNumberI& getValue() const { return *values_[name_]; } virtual void setValue(const std::string& tag, double value) throw (Exception) { if (tag == name_) setValue(value); else throw Exception("SimpleMafStatisticsResult::setValue(). Unvalid tag name: " + tag + "."); } virtual void setValue(const std::string& tag, int value) throw (Exception) { if (tag == name_) setValue(value); else throw Exception("SimpleMafStatisticsResult::setValue(). Unvalid tag name: " + tag + "."); } virtual void setValue(const std::string& tag, unsigned int value) throw (Exception) { if (tag == name_) setValue(value); else throw Exception("SimpleMafStatisticsResult::setValue(). Unvalid tag name: " + tag + "."); } virtual void setValue(double value) { if (values_[name_]) delete values_[name_]; values_[name_] = new BppDouble(value); } virtual void setValue(int value) { if (values_[name_]) delete values_[name_]; values_[name_] = new BppInteger(value); } virtual void setValue(unsigned int value) { if (values_[name_]) delete values_[name_]; values_[name_] = new BppUnsignedInteger(value); } }; /** * @brief General interface for computing statistics based on a Maf block. * * @author Julien Dutheil * @see MafBlock */ class MafStatistics { public: MafStatistics() {} virtual ~MafStatistics() {} public: virtual std::string getShortName() const = 0; virtual std::string getFullName() const = 0; virtual const MafStatisticsResult& getResult() const = 0; virtual void compute(const MafBlock& block) = 0; /** * @return A vector with all available tags. */ virtual std::vector getSupportedTags() const = 0; }; /** * @brief Partial implementation of MafStatistics, for convenience. */ class AbstractMafStatistics: public virtual MafStatistics { protected: MafStatisticsResult result_; public: AbstractMafStatistics(): result_() {} virtual ~AbstractMafStatistics() {} public: const MafStatisticsResult& getResult() const { return result_; } }; /** * @brief Partial implementation of MafStatistics, for convenience. */ class AbstractMafStatisticsSimple: public MafStatistics { protected: SimpleMafStatisticsResult result_; public: AbstractMafStatisticsSimple(const std::string& name): result_(name) {} virtual ~AbstractMafStatisticsSimple() {} public: const SimpleMafStatisticsResult& getResult() const { return result_; } std::vector getSupportedTags() const { return result_.getAvailableTags(); } }; /** * @brief Computes the pairwise divergence for a pair of sequences in a maf block. */ class PairwiseDivergenceMafStatistics: public AbstractMafStatisticsSimple { private: std::string species1_; std::string species2_; public: PairwiseDivergenceMafStatistics(const std::string& species1, const std::string& species2): AbstractMafStatisticsSimple("Divergence"), species1_(species1), species2_(species2) {} ~PairwiseDivergenceMafStatistics() {} public: std::string getShortName() const { return "Div." + species1_ + "-" + species2_; } std::string getFullName() const { return "Pairwise divergence between " + species1_ + " and " + species2_ + "."; } void compute(const MafBlock& block); }; /** * @brief Computes the number of sequences in a maf block. */ class BlockSizeMafStatistics: public AbstractMafStatisticsSimple { public: BlockSizeMafStatistics(): AbstractMafStatisticsSimple("BlockSize") {} ~BlockSizeMafStatistics() {} public: std::string getShortName() const { return "BlockSize"; } std::string getFullName() const { return "Number of sequences."; } void compute(const MafBlock& block) { result_.setValue(static_cast(block.getNumberOfSequences())); } }; /** * @brief Computes the number of columns in a maf block. */ class BlockLengthMafStatistics: public AbstractMafStatisticsSimple { public: BlockLengthMafStatistics(): AbstractMafStatisticsSimple("BlockLength") {} ~BlockLengthMafStatistics() {} public: std::string getShortName() const { return "BlockLength"; } std::string getFullName() const { return "Number of sites."; } void compute(const MafBlock& block) { result_.setValue(static_cast(block.getNumberOfSites())); } }; /** * @brief Retrieve the sequence length (number of nucleotides) for a given species in a maf block. * * If no sequence is found for the current block, 0 is returned. * If several sequences are found for a given species, an exception is thrown. */ class SequenceLengthMafStatistics: public AbstractMafStatisticsSimple { private: std::string species_; public: SequenceLengthMafStatistics(const std::string& species): AbstractMafStatisticsSimple("BlockSize"), species_(species) {} ~SequenceLengthMafStatistics() {} public: std::string getShortName() const { return "SequenceLengthFor" + species_; } std::string getFullName() const { return "Sequence length for species " + species_; } void compute(const MafBlock& block) { std::vector seqs = block.getSequencesForSpecies(species_); if (seqs.size() == 0) result_.setValue(0.); else if (seqs.size() == 1) result_.setValue(static_cast(SequenceTools::getNumberOfSites(*seqs[0]))); else throw Exception("SequenceLengthMafStatistics::compute. More than one sequence found for species " + species_ + " in current block."); } }; /** * @brief Retrieves the alignment score of a maf block. */ class AlignmentScoreMafStatistics: public AbstractMafStatisticsSimple { public: AlignmentScoreMafStatistics(): AbstractMafStatisticsSimple("AlnScore") {} ~AlignmentScoreMafStatistics() {} public: std::string getShortName() const { return "AlnScore"; } std::string getFullName() const { return "Alignment score."; } void compute(const MafBlock& block) { result_.setValue(block.getScore()); } }; /** * @brief Compute the base frequencies of a maf block. * * For each block, provides the following numbers (with their corresponding tags): * - A: total counts of A * - C: total counts of C * - G: total counts of G * - T [or U]: total counts of T/U * - Gap: total counts of gaps * - Unresolved: total counts of unresolved characters * The sum of all characters should equal BlockSize x BlockLength */ class CharacterCountsMafStatistics: public AbstractMafStatistics { private: const Alphabet* alphabet_; public: CharacterCountsMafStatistics(const Alphabet* alphabet): AbstractMafStatistics(), alphabet_(alphabet) {} CharacterCountsMafStatistics(const CharacterCountsMafStatistics& stats): AbstractMafStatistics(stats), alphabet_(stats.alphabet_) {} CharacterCountsMafStatistics& operator=(const CharacterCountsMafStatistics& stats) { AbstractMafStatistics::operator=(stats); alphabet_ = stats.alphabet_; return *this; } virtual ~CharacterCountsMafStatistics() {} public: std::string getShortName() const { return "Count"; } std::string getFullName() const { return "Character counts."; } void compute(const MafBlock& block); std::vector getSupportedTags() const; }; /** * @brief Partial implementation of MafStatistics for method working on a subset of species, in a site-wise manner. * * This class stores a selection of species and create for each block the corresponding SiteContainer instance. */ class AbstractSpeciesSelectionMafStatistics: public virtual MafStatistics { private: std::vector species_; public: AbstractSpeciesSelectionMafStatistics(const std::vector& species): species_(species) {} protected: SiteContainer* getSiteContainer_(const MafBlock& block); }; /** * @brief Partial implementation of MafStatistics for method working on multiple distinct subsets of species, in a site-wise manner. * * This class stores two non-overlapping selections of species and create for each block the corresponding SiteContainer instances. */ class AbstractSpeciesMultipleSelectionMafStatistics: public virtual MafStatistics { private: std::vector< std::vector > species_; public: AbstractSpeciesMultipleSelectionMafStatistics(const std::vector< std::vector >& species); protected: std::vector getSiteContainers_(const MafBlock& block); }; /** * @brief Compute the Site Frequency Spectrum of a maf block. * * If no outgroup is provided, the ancestral states are considered as unknown * and the unfolded spectrum is computed, so that 10000 and 11110 sites are treated equally. */ class SiteFrequencySpectrumMafStatistics: public AbstractMafStatistics, public AbstractSpeciesSelectionMafStatistics { private: class Categorizer { private: std::vector bounds_; public: Categorizer(const std::vector& bounds): bounds_(bounds) { std::sort(bounds_.begin(), bounds_.end()); } public: size_t getNumberOfCategories() const { return (bounds_.size() - 1); } //Category numbers start at 1! size_t getCategory(double value) const throw (OutOfRangeException) { if (value < bounds_[0]) throw OutOfRangeException("SiteFrequencySpectrumMafStatistics::Categorizer::getCategory.", value, *bounds_.begin(), *bounds_.rbegin()); for (size_t i = 1; i < bounds_.size(); ++i) { if (value < bounds_[i]) return i; } throw OutOfRangeException("SiteFrequencySpectrumMafStatistics::Categorizer::getCategory.", value, *bounds_.begin(), *bounds_.rbegin()); } }; private: const Alphabet* alphabet_; Categorizer categorizer_; std::vector counts_; std::string outgroup_; public: SiteFrequencySpectrumMafStatistics(const Alphabet* alphabet, const std::vector& bounds, const std::vector& ingroup, const std::string outgroup = ""): AbstractMafStatistics(), AbstractSpeciesSelectionMafStatistics(ingroup), alphabet_(alphabet), categorizer_(bounds), counts_(bounds.size() - 1), outgroup_(outgroup) {} SiteFrequencySpectrumMafStatistics(const SiteFrequencySpectrumMafStatistics& stats): AbstractMafStatistics(), AbstractSpeciesSelectionMafStatistics(stats), alphabet_(stats.alphabet_), categorizer_(stats.categorizer_), counts_(stats.counts_), outgroup_(stats.outgroup_) {} SiteFrequencySpectrumMafStatistics& operator=(const SiteFrequencySpectrumMafStatistics& stats) { AbstractMafStatistics::operator=(stats); AbstractSpeciesSelectionMafStatistics::operator=(stats); alphabet_ = stats.alphabet_; categorizer_ = stats.categorizer_; counts_ = stats.counts_; outgroup_ = stats.outgroup_; return *this; } virtual ~SiteFrequencySpectrumMafStatistics() {} public: std::string getShortName() const { return "SiteFrequencySpectrum"; } std::string getFullName() const { return "Site frequency spectrum."; } void compute(const MafBlock& block); std::vector getSupportedTags() const; }; /** * @brief Compute the frequency of site patterns for a quadruplet of species. * * Only parsimony informative sites are categorized. * Species: A B C D * P1 1 1 0 0 * P2 0 1 1 0 * P3 1 0 1 0 * Sites with more than two states are ignored, as well as sites containing gaps or unresolved characters. */ class FourSpeciesPatternCountsMafStatistics: public AbstractMafStatistics, public AbstractSpeciesSelectionMafStatistics { private: const Alphabet* alphabet_; std::vector counts_; public: FourSpeciesPatternCountsMafStatistics( const Alphabet* alphabet, const std::vector& species): AbstractMafStatistics(), AbstractSpeciesSelectionMafStatistics(species), alphabet_(alphabet), counts_(6) { if (species.size() != 4) throw Exception("FourSpeciesPatternCountsMafStatistics, constructor: 4 species should be provided."); if (VectorTools::unique(species).size() != 4) throw Exception("FourSpeciesPatternCountsMafStatistics, constructor: duplicated species name!"); } FourSpeciesPatternCountsMafStatistics(const FourSpeciesPatternCountsMafStatistics& stats): AbstractMafStatistics(), AbstractSpeciesSelectionMafStatistics(stats), alphabet_(stats.alphabet_), counts_(stats.counts_) {} FourSpeciesPatternCountsMafStatistics& operator=(const FourSpeciesPatternCountsMafStatistics& stats) { AbstractMafStatistics::operator=(stats); AbstractSpeciesSelectionMafStatistics::operator=(stats); alphabet_ = stats.alphabet_; counts_ = stats.counts_; return *this; } virtual ~FourSpeciesPatternCountsMafStatistics() {} public: std::string getShortName() const { return "FourSpeciesPatternCounts"; } std::string getFullName() const { return "FourSpecies pattern counts."; } void compute(const MafBlock& block); std::vector getSupportedTags() const; }; /** * @brief Compute a few site statistics in a maf block. * * Computed statistics include: * - Number of sites without gaps * - Number of complete sites (no gap, no unresolved) * - Number of parsimony informative sites */ class SiteMafStatistics: public AbstractMafStatistics, public AbstractSpeciesSelectionMafStatistics { public: SiteMafStatistics(const std::vector& species): AbstractMafStatistics(), AbstractSpeciesSelectionMafStatistics(species) {} virtual ~SiteMafStatistics() {} public: std::string getShortName() const { return "SiteStatistics"; } std::string getFullName() const { return "Site statistics."; } void compute(const MafBlock& block); std::vector getSupportedTags() const; }; /** * @brief Counts number of polymorphic / fixed sites in two populations. * * The two populations are defined as two distinct sets of species. * The following counts are computed and returned: * - P: number of sites polymorphic in both populations * - F: number of sites fixed in both populations * - FF: number of sites fixed in both populations, but with distinct states * - PF / FP: number of sites polymorphic in one species and fixed in the other. * - X: unresolved (because of gap or generic character) * - FX / PX / XF / XP: unresolved in one population */ class PolymorphismMafStatistics: public AbstractMafStatistics, public AbstractSpeciesMultipleSelectionMafStatistics { public: PolymorphismMafStatistics(const std::vector< std::vector >& species): AbstractMafStatistics(), AbstractSpeciesMultipleSelectionMafStatistics(species) { if (species.size() != 2) throw Exception("PolymorphismStatistics: exactly two species selection should be provided."); } virtual ~PolymorphismMafStatistics() {} public: std::string getShortName() const { return "PolymorphismStatistics"; } std::string getFullName() const { return "Polymorphism statistics."; } void compute(const MafBlock& block); std::vector getSupportedTags() const; private: static std::vector getPatterns_(const SiteContainer& sites); }; /** * @brief Provide estimates of sequence diversity. * * - Number of segregating sites * - Watterson's theta (per site) * * Only fully resolved sites are analyzed (no gap, no generic character). */ class SequenceDiversityMafStatistics: public AbstractMafStatistics, public AbstractSpeciesSelectionMafStatistics { public: SequenceDiversityMafStatistics(const std::vector& ingroup): AbstractMafStatistics(), AbstractSpeciesSelectionMafStatistics(ingroup) {} virtual ~SequenceDiversityMafStatistics() {} public: std::string getShortName() const { return "SequenceDiversityStatistics"; } std::string getFullName() const { return "Sequence diversity statistics."; } void compute(const MafBlock& block); std::vector getSupportedTags() const; private: static std::vector getPatterns_(const SiteContainer& sites); }; } // end of namespace bpp #endif //_MAFSTATISTICS_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Fastq.h000664 001750 001750 00000010006 12372454303 021514 0ustar00jdutheiljdutheil000000 000000 // // File: Fastq.h // Author: Sylvain Gaillard // Created: 22/11/2011 09:56:24 // /* Copyright or © or Copr. Bio++ Development Team, (November 22, 2011) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _BPP_SEQ_IO_FASTQ_H_ #define _BPP_SEQ_IO_FASTQ_H_ #include #include #include #include #include namespace bpp { /** * @brief The fastq sequence file format. * * @author Sylvain Gaillard */ class Fastq: public virtual ISequenceStream, public virtual OSequenceStream { private: bool repeatName_; public: /** * @brief Build a new Fastq object. * * @param repName Tell if the names in the file is repeated (tested * on input) or must be repeated (for output). */ Fastq(bool repName = false): repeatName_(repName) {} // Class destructor virtual ~Fastq() {} public: /** * @name The IOSequence interface. * * @{ */ const std::string getFormatName() const { return "FASTQ file"; } const std::string getFormatDescription() const { return "Sequence with quality"; } const std::string getDataType() const { return "Sequence with quality"; } /** @} */ bool repeatName() const { return repeatName_; } void repeatName(bool yn) { repeatName_ = yn; } /** * @name The ISequenceStream interface. * * @{ */ /** * @copydoc bpp::ISequenceStream::nextSequence() * @author Sylvain Gaillard * * @par Usage * * @code * // Creating a SequenceWithQuality object * DNA alpha; * SequenceWithQuality seq(&alpha); * * // Create a FastQ parser * Fastq fq; * * // Opening the file * std::ifstream in("reads.fastq"); * * // Read the sequences * while (fq.nextSequence(in, seq)) { * // ... do something with the sequence ... * } * * // Close the file * in.close(); * @endcode */ bool nextSequence(std::istream& input, Sequence& seq) const throw (Exception); /** @} */ /** * @name The OSequenceStream interface. * * @{ */ /** * @copydoc OSequenceStream::writeSequence() * @author Sylvain Gaillard */ void writeSequence(std::ostream& output, const Sequence& seq) const throw (Exception); /** @} */ }; } #endif // _BPP_SEQ_IO_FASTQ_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Io/Fastq.cpp000664 001750 001750 00000007412 12372454303 022056 0ustar00jdutheiljdutheil000000 000000 // // File: Fastq.cpp // Author: Sylvain Gaillard // Created: 22/11/2011 09:56:29 // /* Copyright or © or Copr. Bio++ Development Team, (November 22, 2011) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "Fastq.h" #include #include using namespace bpp; bool Fastq::nextSequence(std::istream& input, Sequence& seq) const throw (Exception) { if (input && ! input.eof()) { //SequenceWithQuality& sq; std::string buffer; while (TextTools::isEmpty(buffer) && !input.eof()) { getline(input, buffer); } if (input.eof()) { // We hit the end of the file return false; } // first line: seq name if (buffer[0] == '@') { seq.setName(std::string(buffer.begin() + 1, buffer.end())); } // second line: seq getline(input, buffer); seq.setContent(buffer); // third line: seq name (again) getline(input, buffer); if (repeatName()) { std::string secName = std::string(buffer.begin() + 1, buffer.end()); if (secName != seq.getName()) { throw Exception("Names are not equivalent for sequence(@ line) and quality (+ line)"); } } // fourth line: quality getline(input, buffer); try { SequenceWithQuality& sq = dynamic_cast(seq); for (size_t i = 0 ; i < buffer.size() ; i++) { sq.setQuality(i, static_cast(buffer[i])); } } catch (...) { } return true; } return false; } /******************************************************************************/ void Fastq::writeSequence(std::ostream& output, const Sequence& seq) const throw (Exception) { std::string qual(seq.size(), static_cast(33)); try { const SequenceWithQuality& sq = dynamic_cast(seq); for (size_t i = 0 ; i < sq.size() ; i++) { char q = static_cast(sq.getQuality(i)); if (q < 33 || q > 126) { throw BadIntegerException("Quality must lie between 33 and 126", q); } qual[i] = q; } } catch (const std::bad_cast& e) { throw Exception("seq must be a SequenceWithQuality object"); } output << "@" << seq.getName() << std::endl; output << seq.toString() << std::endl; output << "+"; if (repeatName()) { output << seq.getName(); } output << std::endl; output << qual << std::endl; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/FeatureReader.h000664 001750 001750 00000004723 12372454303 024211 0ustar00jdutheiljdutheil000000 000000 // // File: FeatureReader.h // Created by: Julien Dutheil // Created on: Thu Nov 22 2012 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _FEATUREREADER_H_ #define _FEATUREREADER_H_ #include "SequenceFeature.h" //From bpp-core: #include //From the STL: #include #include namespace bpp { /** * @brief Interface for feature readers. * * @author Julien Dutheil, Sylvain Gaillard */ class FeatureReader { public: FeatureReader() {} virtual ~FeatureReader() {} public: virtual bool hasMoreFeature() const = 0; virtual const BasicSequenceFeature nextFeature() throw (Exception) = 0; virtual void getAllFeatures(SequenceFeatureSet& features) = 0; virtual void getFeaturesOfType(const std::string& type, SequenceFeatureSet& features) = 0; virtual void getFeaturesOfSequence(const std::string& seqId, SequenceFeatureSet& features) = 0; }; } //end of namespace bpp #endif //_FEATUREREADER_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/SequenceFeature.h000664 001750 001750 00000036567 12372454303 024572 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceFeature.h // Created by: Julien Dutheil // Created on: Mon Nov 21 2011 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _SEQUENCEFEATURE_H_ #define _SEQUENCEFEATURE_H_ //From the STL: #include #include #include #include //From bpp-core: #include #include /** * @mainpage * * @par * The bpp-seq-omics library adds 'omics' components to the bpp-seq library. * These components notably include the bpp::SequenceFeature class, for storing generic sequence features and their coordinates. * Parsers are provided for loading such features from a bpp::Gff file for instance, as well as tools for extracting the corresponding sequences (bpp::SequenceFeatureTools). * * @par * Next-Generation Sequencing data are also supported, with the bpp::Fastq parser, which instanciates bpp::SequenceWithQuality objects. * Genome alignments can be efficiently analyzed via the bpp::MafParser class and a large range of bpp::MafIterator classes. * Genome alignment blocks are stored in bpp::MafBlock instances, which are containers of bpp::MafSequence objects with their corresponding genome coordinates. */ namespace bpp { /** * @brief a coordinate range on a sequence. * Stores coordinates as a Range object, * but also keep the strand information. */ class SeqRange: public Range { private: char strand_; public: /** * @param a First position * @param b Second position * @param strand The strand information. Can take one of the four values: '+' for positive strand, '-' for negative, '.' if not stranded or '?' if strandedness is relevant but unknown. */ SeqRange(size_t a, size_t b, char strand = '.'): Range(a, b), strand_(strand) { if (strand != '+' && strand != '-' && strand != '?' && strand != '.') strand_ = '.'; } SeqRange* clone() const { return new SeqRange(*this); } public: virtual char getStrand() const { return strand_; } virtual bool isNegativeStrand() const { return strand_ == '-'; } virtual bool isStranded() const { return strand_ == '+' || strand_ == '-'; } virtual void invert() { if (isStranded()) { if (isNegativeStrand()) { strand_ = '+'; } else { strand_ = '-'; } } } }; /** * @brief The base interface for sequence features. * * This interface provides the most generic information common to all features, that is: * - sequence reference * - procedure used to generate the information * - start and end positions. Coordinates are 0-based, of type [a,b[, so that if a==b, * the annotation is considered empty. A one-character annotation is then noted as start=12(included),end=13(excluded) for instance. * * Subclasses inheriting this interface provide specialisations for various types of annotations. * Depending on the file format of annotations, not all types of annotations may be supported. * * @author Julien Dutheil */ class SequenceFeature: public virtual Clonable { public: static const std::string NO_ATTRIBUTE_SET; public: virtual SequenceFeature* clone() const = 0; public: /** * @return The id of this feature. */ virtual const std::string& getId() const = 0; /** * @param id A std::string representing the id. */ virtual void setId(const std::string& id) = 0; /** * @return The id of the sequence on which this feature is based. */ virtual const std::string& getSequenceId() const = 0; /** * @param id A std::string representing the id of the reference. */ virtual void setSequenceId(const std::string& id) = 0; /** * @return A text intended to describe the algorithm or procedure used to generate the feature. */ virtual const std::string& getSource() const = 0; /** * @param source A std::string representing the source of the feature. */ virtual void setSource(const std::string& source) = 0; /** * @return A text describing the type of feature. Depending on the format, it can be restricted (for example, mRNA), or any text can be supplied (for example TFXX binding site). */ virtual const std::string& getType() const = 0; /** * @param type A std::string representing the type of this feature. */ virtual void setType(const std::string& type) = 0; /** * @return The starting position of the feature, 0-based, included. */ virtual const size_t getStart() const = 0; /** * @return The ending position of the feature, 0-based, excluded. */ virtual const size_t getEnd() const = 0; /** * @return True if the feature is stranded. */ virtual bool isStranded() const = 0; /** * @return True if the sequence is coded on the negative strand. False if it is on the positive one or unknown. */ virtual bool isNegativeStrand() const = 0; /** * Change the orientation of the feature. */ virtual void invert() = 0; /** * @return Coordinates as a Range object. */ virtual SeqRange getRange() const = 0; /** * @return True if the features overlap. */ virtual bool overlap(const SequenceFeature& feat) const = 0; /** * @return The score associated to the feature (eg, an E-value or a P-value). */ virtual const double& getScore() const = 0; /** * @param score A double representing the score of this feature. */ virtual void setScore(double score) = 0; /** * @param attribute The name of the attribute to retrieve. * @return The attribute with specified name (read only). */ virtual const std::string& getAttribute(const std::string& attribute) const = 0; /** * @param attribute The name of the attribute to retrieve. * @return The attribute with specified name. */ virtual std::string& getAttribute(const std::string& attribute) = 0; /** * @return The list of all attributes available. */ virtual std::set< std::string > getAttributeList() const = 0; /** * @brief Set the value of an attribute. * * @param attribute The name of the attribute to set. * @param value The value of the attribute to set. */ virtual void setAttribute(const std::string& attribute, const std::string& value) = 0; /** * @param attribute The name of the attribute to be removed. */ virtual void removeAttribute(const std::string& attribute) = 0; }; /** * @brief A very simple implementation of the SequenceFeature class. * * It uses a hash map for storing attributes. */ class BasicSequenceFeature: public SequenceFeature { protected: std::string id_; std::string sequenceId_; std::string source_; std::string type_; SeqRange range_; double score_; mutable std::map attributes_; //SequenceFeatureSet subFeatures_; public: BasicSequenceFeature( const std::string& id, const std::string& seqId, const std::string& source, const std::string& type, size_t start, size_t end, char strand, double score = -1): id_(id), sequenceId_(seqId), source_(source), type_(type), range_(start, end, strand), score_(score), attributes_() //attributes_(), subFeatures_() {} virtual BasicSequenceFeature* clone() const { return new BasicSequenceFeature(*this); } public: const std::string& getId() const { return id_; } void setId(const std::string& id) { id_ = id; } const std::string& getSequenceId() const { return sequenceId_; } void setSequenceId(const std::string& sid) { sequenceId_ = sid; } const std::string& getSource() const { return source_; } void setSource(const std::string& source) { source_ = source; } const std::string& getType() const { return type_; } void setType(const std::string& type) { type_ = type; } const size_t getStart() const { return range_.begin(); } const size_t getEnd() const { return range_.end(); } bool isStranded() const { return range_.isStranded(); } bool isNegativeStrand() const { return range_.isNegativeStrand(); } void invert() { range_.invert(); } const double& getScore() const { return score_; } void setScore(double score) { score_ = score; } const std::string& getAttribute(const std::string& attribute) const { std::map::iterator it = attributes_.find(attribute); if (it != attributes_.end()) return it->second; else return NO_ATTRIBUTE_SET; } std::string& getAttribute(const std::string& attribute) { return attributes_[attribute]; } void setAttribute(const std::string& attribute, const std::string& value) { attributes_[attribute] = value; } std::set< std::string > getAttributeList() const { std::set< std::string > d; for (std::map::iterator it = attributes_.begin() ; it != attributes_.end() ; it++) { d.insert(it->first); } return d; } void removeAttribute(const std::string& attribute) { std::map::iterator it = attributes_.find(attribute); if (it != attributes_.end()) { attributes_.erase(it); } } SeqRange getRange() const { return SeqRange(range_); } bool overlap(const SequenceFeature& feat) const { if (feat.getSequenceId() == sequenceId_) { return range_.overlap(feat.getRange()); } return false; } //const SequenceFeatureSet& getSubFeatures() const { return subFeatures; } //SequenceFeatureSet& getSubFeatures() { return subFeatures; } }; /** * @brief A simple ensemble of sequence features. * * This class is at a draft stage, and further improvements are expected, notably * to allow proper indexation, nested features, etc. * * For now, it is mostly a vector of feature object, stored as pointers. * A few functions are provided for convenience. * * @author Julien Dutheil */ class SequenceFeatureSet { private: std::vector features_; public: SequenceFeatureSet(): features_() {}; virtual ~SequenceFeatureSet() { clear(); } SequenceFeatureSet(const SequenceFeatureSet& sfs): features_() { for (std::vector::const_iterator it = sfs.features_.begin(); it != sfs.features_.end(); ++it) { features_.push_back((**it).clone()); } } SequenceFeatureSet& operator=(const SequenceFeatureSet& sfs) { clear(); for (std::vector::const_iterator it = sfs.features_.begin(); it != sfs.features_.end(); ++it) { features_.push_back((**it).clone()); } return *this; } public: /** * @brief Delete all features in this set. */ void clear() { for (std::vector::iterator it = features_.begin(); it != features_.end(); ++it) { delete *it; } features_.clear(); } /** * @param i The index of the feature. * @return A reference toward the feature. */ const SequenceFeature& getFeature(size_t i) const { return *features_[i]; } /** * @param i The index of the feature. * @return A reference toward the feature. * @see getFeature(size_t i) */ const SequenceFeature& operator[](size_t i) const { return *features_[i]; } /** * @return The number of features in this set. */ size_t getNumberOfFeatures() const { return features_.size(); } /** * @brief Add a feature to the container. The feature will be copied and the copy owned by the container. * * @param feature The feature to add to the container. */ void addFeature(const SequenceFeature& feature) { features_.push_back(feature.clone()); } /** * @return A set containing all sequences ids in this set. */ std::set getSequences() const { std::set seqIds; for (std::vector::const_iterator it = features_.begin(); it != features_.end(); ++it) { seqIds.insert((**it).getSequenceId()); } return seqIds; } /** * @return A set containing all feature type in this set. */ std::set getTypes() const { std::set types; for (std::vector::const_iterator it = features_.begin(); it != features_.end(); ++it) { types.insert((**it).getType()); } return types; } /** * @brief Get all coordinates of features for a given source. * All ranges are added to a RangeCollection container, as SeqRange objects. * @param seqId The name of the sequence id to consider. * @param coords [out] a container where to add the coordinates of each feature. */ void fillRangeCollectionForSequence(const std::string& seqId, RangeCollection& coords) const { for (std::vector::const_iterator it = features_.begin(); it != features_.end(); ++it) { if ((**it).getSequenceId() == seqId) { coords.addRange((**it).getRange()); } } } /** * @param types The feature type. * @return A new set with all features of a given type. */ SequenceFeatureSet* getSubsetForType(const std::vector& types) const { SequenceFeatureSet* subset = new SequenceFeatureSet(); for (std::vector::const_iterator it = features_.begin(); it != features_.end(); ++it) { if (std::find(types.begin(), types.end(), (**it).getType()) != types.end()) { subset->addFeature(**it); } } return subset; } }; } //end of namespace bpp #endif //_SEQUENCEFEATURE_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/SequenceFeature.cpp000664 001750 001750 00000003400 12372454303 025101 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceFeature.cpp // Created by: Julien Dutheil // Created on: Mon Nov 21 2011 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "SequenceFeature.h" using namespace bpp; const std::string SequenceFeature::NO_ATTRIBUTE_SET = ""; bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/Gtf/GtfFeatureReader.h000664 001750 001750 00000007370 12372454303 025373 0ustar00jdutheiljdutheil000000 000000 // // File: GtfFeatureReader.h // Created by: Sylvain Gaillard // Created on: Fry Jan 27 2012 // /* Copyright or © or Copr. Bio++ Development Team, (January 27, 2012) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _GTFFEATUREREADER_H_ #define _GTFFEATUREREADER_H_ #include "../SequenceFeature.h" #include "../FeatureReader.h" //From bpp-core: #include //From the STL: #include #include namespace bpp { /** * @brief A simple reader implementing the Gene Transfer Format. * * The reference norm in use is the one of GTF2.2 http://mblab.wustl.edu/GTF22.html . * This class is a "beta" class, and may undeavour interface changes in the future. * * Note that in GTF, coordinates are [a, b] 1-based. They will therefore be converted to [a, b[ 0-based, * as specified for the SequenceFeature object. * * @author Sylvain Gaillard */ class GtfFeatureReader: public virtual FeatureReader { public: static const std::string GTF_PHASE; static const std::string GTF_GENE_ID; static const std::string GTF_TRANSCRIPT_ID; private: std::istream* input_; std::string nextLine_; public: GtfFeatureReader(std::istream& input): input_(&input), nextLine_() { getNextLine_(); } private: GtfFeatureReader(const GtfFeatureReader& reader): input_(0), nextLine_() {} GtfFeatureReader& operator=(const GtfFeatureReader& reader) { return *this; } public: bool hasMoreFeature() const { return nextLine_ != ""; } const BasicSequenceFeature nextFeature() throw (Exception); void getAllFeatures(SequenceFeatureSet& features) { while (hasMoreFeature()) { features.addFeature(nextFeature()); } } void getFeaturesOfType(const std::string& type, SequenceFeatureSet& features) { while (hasMoreFeature()) { BasicSequenceFeature feature = nextFeature(); if (feature.getType() == type) features.addFeature(feature); } } void getFeaturesOfSequence(const std::string& seqId, SequenceFeatureSet& features) { while (hasMoreFeature()) { BasicSequenceFeature feature = nextFeature(); if (feature.getSequenceId() == seqId) features.addFeature(feature); } } private: void getNextLine_(); }; } //end of namespace bpp #endif //_GTFFEATUREREADER_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/Gtf/GtfFeatureReader.cpp000664 001750 001750 00000012077 12372454303 025726 0ustar00jdutheiljdutheil000000 000000 // // File: GtfFeatureReader.cpp // Created by: Sylvain Gaillard // Created on: Fry Jan 27 2012 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "GtfFeatureReader.h" //From bpp-core: #include #include #include //From the STL: #include #include using namespace bpp; using namespace std; const std::string GtfFeatureReader::GTF_PHASE = "GTF_PHASE"; const std::string GtfFeatureReader::GTF_GENE_ID = "gene_id"; const std::string GtfFeatureReader::GTF_TRANSCRIPT_ID = "transcript_id"; void GtfFeatureReader::getNextLine_() { nextLine_ = ""; // Remove comments /* todo: remove characters between # and end-of-line taking care of double quotes */ while (TextTools::isEmpty(nextLine_) || nextLine_.size() < 2 || nextLine_[0] == '#') { if (input_->eof()) { nextLine_ = ""; return; } getline(*input_, nextLine_); } } const BasicSequenceFeature GtfFeatureReader::nextFeature() throw (Exception) { if (!hasMoreFeature()) throw Exception("GtfFeatureReader::nextFeature(). No more feature in file."); //Parse current line: StringTokenizer st(nextLine_, "\t"); if (st.numberOfRemainingTokens() != 9) throw Exception("GtfFeatureReader::nextFeature(). Wrong GTF file format: should have 9 tab delimited columns."); //if ok, we can parse each column: std::string seqId = st.nextToken(); std::string source = st.nextToken(); std::string type = st.nextToken(); unsigned int start = TextTools::to(st.nextToken()) - 1; unsigned int end = TextTools::to(st.nextToken()); double score = TextTools::to(st.nextToken()); std::string strand = st.nextToken(); std::string phase = st.nextToken(); std::string attrDesc = st.nextToken(); std::map attributes; bpp::StringTokenizer st1(attrDesc, ";"); while (st1.hasMoreToken()) { std::string item(bpp::TextTools::removeSurroundingWhiteSpaces(st1.nextToken())); std::string::size_type idx = item.find_first_of(' '); std::string key(item.substr(0, idx)); std::string value(item.substr(idx)); // remove first " while ( value.size() > 0 && ( value[0] == '"' || bpp::TextTools::isWhiteSpaceCharacter(value[0]) ) ) { value.erase(value.begin()); } // remove last " while ( value.size() > 0 && ( value[value.size() - 1] == '"' || bpp::TextTools::isWhiteSpaceCharacter(value[value.size() - 1]) ) ) { value.erase(value.end() - 1); } attributes[key] = value; //std::cout << "[" << key << "] = [" << value << "]" << std::endl; } //KeyvalTools::multipleKeyvals(attrDesc, attributes, ";", false); //std::string id = attributes["ID"]; std::string id = ""; BasicSequenceFeature feature(id, seqId, source, type, start, end, strand[0], score); //Set phase attributes: phase = bpp::TextTools::removeSurroundingWhiteSpaces(phase); if (phase != ".") feature.setAttribute(GTF_PHASE, phase); //now check additional attributes: for (std::map::iterator it = attributes.begin(); it != attributes.end(); ++it) { feature.setAttribute(it->first, it->second); //We accept all attributes, even if they are not standard. //std::cout << "[" << it->first << "] = [" << it->second << "]" << std::endl; //std::cout << "phase: " << phase << std::endl; } //Read the next line: getNextLine_(); return feature; } bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/Gff/GffFeatureReader.h000664 001750 001750 00000011557 12372454303 025341 0ustar00jdutheiljdutheil000000 000000 // // File: GffFeatureReader.h // Created by: Julien Dutheil // Created on: Mon Nov 21 2011 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _GFFFEATUREREADER_H_ #define _GFFFEATUREREADER_H_ #include "../SequenceFeature.h" #include "../FeatureReader.h" //From bpp-core: #include //From the STL: #include #include namespace bpp { /** * @brief A simple reader implementing the Gene Finding Feature format. * * The reference norm in use is the one of GFF3 http://www.sequenceontology.org/gff3.shtml . * This class is a "beta" class, and may undeavour interface changes in the future. * * Note that in GFF, coordinates are [a, b] 1-based. They will therefore be converted to [a, b[ 0-based, * as specified for the SequenceFeature object. * * @author Julien Dutheil, Sylvain Gaillard */ class GffFeatureReader: public virtual FeatureReader { public: static const std::string GFF_STRAND; static const std::string GFF_PHASE; static const std::string GFF_NAME; static const std::string GFF_ALIAS; static const std::string GFF_PARENT; static const std::string GFF_TARGET; static const std::string GFF_GAP; static const std::string GFF_DERIVES_FROM; static const std::string GFF_NOTE; static const std::string GFF_DBXREF; static const std::string GFF_ONTOLOGY_TERM; static const std::string GFF_IS_CIRCULAR; private: std::istream* input_; std::string nextLine_; public: GffFeatureReader(std::istream& input): input_(&input), nextLine_() { getNextLine_(); } private: GffFeatureReader(const GffFeatureReader& reader): input_(0), nextLine_() {} GffFeatureReader& operator=(const GffFeatureReader& reader) { return *this; } public: bool hasMoreFeature() const { return nextLine_ != ""; } const BasicSequenceFeature nextFeature() throw (Exception); void getAllFeatures(SequenceFeatureSet& features) { while (hasMoreFeature()) { features.addFeature(nextFeature()); } } void getFeaturesOfType(const std::string& type, SequenceFeatureSet& features) { while (hasMoreFeature()) { BasicSequenceFeature feature = nextFeature(); if (feature.getType() == type) features.addFeature(feature); } } void getFeaturesOfSequence(const std::string& seqId, SequenceFeatureSet& features) { while (hasMoreFeature()) { BasicSequenceFeature feature = nextFeature(); if (feature.getSequenceId() == seqId) features.addFeature(feature); } } /** * @param f A sequence feature. * @return A string describing the feature, in GFF format. */ static std::string toString(const bpp::SequenceFeature& f); /** * @brief Out put a string description of a feature to a stream. * * A end of line character will be appended after the description. * * @param f A sequence feature. * @param out An output stream. */ static void toString(const bpp::SequenceFeature& f, std::ostream& out) { out << toString(f) << std::endl; } static void toString(const bpp::SequenceFeatureSet& fs, std::ostream& out) { for (unsigned int i = 0; i < fs.getNumberOfFeatures(); ++i) { toString(fs[i], out); } } private: void getNextLine_(); }; } //end of namespace bpp #endif //_GFFFEATUREREADER_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/Gff/GffFeatureReader.cpp000664 001750 001750 00000012572 12372454303 025672 0ustar00jdutheiljdutheil000000 000000 // // File: GffFeatureReader.cpp // Created by: Julien Dutheil // Created on: Mon Nov 21 2011 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "GffFeatureReader.h" //From bpp-core: #include #include #include #include //From the STL: #include #include using namespace bpp; using namespace std; const std::string GffFeatureReader::GFF_PHASE = "GFF_PHASE"; const std::string GffFeatureReader::GFF_NAME = "Name"; const std::string GffFeatureReader::GFF_ALIAS = "GFF_ALIAS"; const std::string GffFeatureReader::GFF_PARENT = "Parent"; const std::string GffFeatureReader::GFF_TARGET = "Target"; const std::string GffFeatureReader::GFF_GAP = "Gap"; const std::string GffFeatureReader::GFF_DERIVES_FROM = "GFF_DERIVES_FROM"; const std::string GffFeatureReader::GFF_NOTE = "Note"; const std::string GffFeatureReader::GFF_DBXREF = "Dbxref"; const std::string GffFeatureReader::GFF_ONTOLOGY_TERM = "Ontology_term"; const std::string GffFeatureReader::GFF_IS_CIRCULAR = "Is_circular"; void GffFeatureReader::getNextLine_() { nextLine_ = ""; while (TextTools::isEmpty(nextLine_) || nextLine_.size() < 2 || nextLine_[0] == '#') { if (input_->eof()) { nextLine_ = ""; return; } getline(*input_, nextLine_); } } const BasicSequenceFeature GffFeatureReader::nextFeature() throw (Exception) { if (!hasMoreFeature()) throw Exception("GffFeatureReader::nextFeature(). No more feature in file."); //Parse current line: StringTokenizer st(nextLine_, "\t"); if (st.numberOfRemainingTokens() != 9) throw Exception("GffFeatureReader::nextFeature(). Wrong GFF3 file format: should have 9 tab delimited columns."); //if ok, we can parse each column: string seqId = st.nextToken(); string source = st.nextToken(); string type = st.nextToken(); unsigned int start = TextTools::to(st.nextToken()) - 1; unsigned int end = TextTools::to(st.nextToken()); double score = TextTools::to(st.nextToken()); string strand = st.nextToken(); string phase = st.nextToken(); string attrDesc = st.nextToken(); map attributes; KeyvalTools::multipleKeyvals(attrDesc, attributes, ";", false); string id = attributes["ID"]; BasicSequenceFeature feature(id, seqId, source, type, start, end, strand[0], score); //Set phase attributes: if (phase != ".") feature.setAttribute(GFF_PHASE, phase); //now check additional attributes: for (map::iterator it = attributes.begin(); it != attributes.end(); ++it) { if (it->first != "ID") feature.setAttribute(it->first, it->second); //We accept all attributes, even if they are not standard. } //Read the next line: getNextLine_(); return feature; } std::string GffFeatureReader::toString(const bpp::SequenceFeature& f) { std::vector< std::string > v; std::vector< std::string > attr; std::set< std::string > attrNames = f.getAttributeList(); v.push_back(f.getSequenceId()); v.push_back(f.getSource()); v.push_back(f.getType()); v.push_back(bpp::TextTools::toString(f.getStart() + 1)); v.push_back(bpp::TextTools::toString(f.getEnd())); v.push_back(bpp::TextTools::toString(f.getScore())); if (f.isStranded()) { if (f.isNegativeStrand()) { v.push_back("-"); } else { v.push_back("+"); } } else { v.push_back("."); } if (f.getAttribute(GFF_PHASE) == "") { v.push_back("."); } else { v.push_back(f.getAttribute(GFF_PHASE)); } if (f.getId() != "") { attr.push_back("ID=" + f.getId()); } for (std::set< std::string >::iterator it = attrNames.begin() ; it != attrNames.end() ; it++) { attr.push_back(*it + "=" + f.getAttribute(*it)); } v.push_back(bpp::VectorTools::paste(attr, ";")); return bpp::VectorTools::paste(v, "\t"); } bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/SequenceFeatureTools.h000664 001750 001750 00000005564 12407766152 025613 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceFeatureTools.h // Created by: Julien Dutheil // Created on: Mon Jul 30 2012 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #ifndef _SEQUENCEFEATURETOOLS_H_ #define _SEQUENCEFEATURETOOLS_H_ #include "SequenceFeature.h" //From bpp-seq: #include #include namespace bpp { class SequenceFeatureTools { public: /** * @brief Extract a sub-sequence given a SeqRange. * * The sub-sequence is revese-complemented if SeqRange is in negative * strand. * * @param seq The Sequence to trunc. * @param range The SeqRange to extract. * @return A new Sequence object with the given subsequence oriented * according to the SeqRange. * @author Sylvain Gaillard */ static Sequence* extract(const Sequence& seq, const SeqRange& range); /** * @brief Get ORF features for a Sequence. * * @param seq The Sequence where to find ORF. Must be a nucleic sequence. * @param featSet A SequenceFeatureSet to fill with the annotations. * @param gCode The genetic code to use. * @return The number of ORF found. * @author Sylvain Gaillard */ static unsigned int getOrfs(const Sequence& seq, SequenceFeatureSet& featSet, const GeneticCode& gCode); }; } //end of namespace bpp #endif //_SEQUENCEFEATURETOOLS_H_ bpp-seq-omics-2.2.0/src/Bpp/Seq/Feature/SequenceFeatureTools.cpp000664 001750 001750 00000010070 12407765466 026141 0ustar00jdutheiljdutheil000000 000000 // // File: SequenceFeatureTools.h // Created by: Julien Dutheil // Created on: Mon Jul 30 2012 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for sequences analysis. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include "SequenceFeatureTools.h" //From bpp-seq: #include #include #include #include //From STL #include using namespace bpp; /******************************************************************************/ Sequence* SequenceFeatureTools::extract(const Sequence& seq, const SeqRange& range) { if (range.end() > seq.size()) throw IndexOutOfBoundsException ("SequenceTools::extract: Invalid upper bound", range.end(), 0, seq.size()); Sequence* sout = SequenceTools::subseq(seq, range.begin(), range.end() - 1); if (range.isNegativeStrand()) { SequenceTools::invertComplement(*sout); } return sout; } /******************************************************************************/ unsigned int SequenceFeatureTools::getOrfs(const Sequence& seq, SequenceFeatureSet& featSet, const GeneticCode& gCode) { if (! AlphabetTools::isNucleicAlphabet(seq.getAlphabet())) { throw AlphabetException("SequenceFeatureTools::getOrfs: Sequence alphabet must be nucleic!", seq.getAlphabet()); } unsigned int orfCpt = 0; const CodonAlphabet* codonAlpha = gCode.getSourceAlphabet(); std::vector< std::vector > starts(3), stops(3); size_t phase = 0; for (size_t p = 0 ; p < seq.size() - 2 ; p++) { phase = p % 3; if (gCode.isStart(codonAlpha->getCodon(seq.getValue(p), seq.getValue(p + 1), seq.getValue(p + 2)))) { starts[phase].push_back(p); //std::cerr << "Start: " << p << " (" << phase << ")" << std::endl; } else if (gCode.isStop(codonAlpha->getCodon(seq.getValue(p), seq.getValue(p + 1), seq.getValue(p + 2)))) { stops[phase].push_back(p); //std::cerr << "Stop: " << p << " (" << phase << ")" << std::endl; } } for (size_t i = 0 ; i < 3 ; ++i) { std::vector< size_t >::iterator start(starts[i].begin()), stop(stops[i].begin()); while (stop != stops[i].end() && start != starts[i].end()) { if (*stop < *start) { stop++; } else { orfCpt++; //std::cerr << "ORF: " << *start << " - " << *stop + 2 << " (" << i << ")" << std::endl; bpp::BasicSequenceFeature feat("", seq.getName(), "Bio++", "CDS", *start, *stop + 2, '+'); featSet.addFeature(feat); start++; } } } return orfCpt; } /******************************************************************************/ bpp-seq-omics-2.2.0/INSTALL.txt000664 001750 001750 00000000700 12372454303 017525 0ustar00jdutheiljdutheil000000 000000 This software needs cmake >= 2.6 to build. After installing cmake, run it with the following command: cmake -DCMAKE_INSTALL_PREFIX=[where to install, for instance /usr/local or $HOME/.local] . If available, you can also use ccmake instead of cmake for a more user-friendly interface. Then compile and install the software with make install You may also consider installing and using the software checkinstall for easier system administration. bpp-seq-omics-2.2.0/bpp-seq-omics.spec000664 001750 001750 00000010752 12407765466 021237 0ustar00jdutheiljdutheil000000 000000 %define _basename bpp-seq-omics %define _version 2.2.0 %define _release 1 %define _prefix /usr URL: http://biopp.univ-montp2.fr/ Name: %{_basename} Version: %{_version} Release: %{_release} License: CECILL-2.0 Vendor: The Bio++ Project Source: http://biopp.univ-montp2.fr/repos/sources/%{_basename}-%{_version}.tar.gz Summary: Bio++ Sequence library: genomics components Group: Development/Libraries/C and C++ Requires: bpp-core = %{_version} Requires: bpp-seq = %{_version} BuildRoot: %{_builddir}/%{_basename}-root BuildRequires: cmake >= 2.6.0 BuildRequires: gcc-c++ >= 4.0.0 BuildRequires: libbpp-core2 = %{_version} BuildRequires: libbpp-core-devel = %{_version} BuildRequires: libbpp-seq9 = %{_version} BuildRequires: libbpp-seq-devel = %{_version} AutoReq: yes AutoProv: yes %description This library contains the genomics components of the Bio++ sequence library. It is part of the Bio++ project. %package -n libbpp-seq-omics1 Summary: Bio++ Sequence library: genomics components Group: Development/Libraries/C and C++ %description -n libbpp-seq-omics1 This library contains the genomics components of the Bio++ sequence library. It is part of the Bio++ project. %package -n libbpp-seq-omics-devel Summary: Bio++ Sequence library: genomics components Group: Development/Libraries/C and C++ Requires: libbpp-seq-omics1 = %{_version} Requires: libbpp-seq9 = %{_version} Requires: libbpp-seq-devel = %{_version} Requires: libbpp-core2 = %{_version} Requires: libbpp-core-devel = %{_version} %description -n libbpp-seq-omics-devel The libbpp-seq-omics-devel package contains the header files and static libraries for building applications which use %{_basename}. %prep %setup -q %build CFLAGS="$RPM_OPT_FLAGS" CMAKE_FLAGS="-DCMAKE_INSTALL_PREFIX=%{_prefix} -DBUILD_TESTING=OFF" if [ %{_lib} == 'lib64' ] ; then CMAKE_FLAGS="$CMAKE_FLAGS -DLIB_SUFFIX=64" fi cmake $CMAKE_FLAGS . make %install make DESTDIR=$RPM_BUILD_ROOT install %clean rm -rf $RPM_BUILD_ROOT %post -n libbpp-seq-omics1 -p /sbin/ldconfig %post -n libbpp-seq-omics-devel createGeneric() { echo "-- Creating generic include file: $1.all" #Make sure we run into subdirectories first: dirs=() for file in "$1"/* do if [ -d "$file" ] then # Recursion: dirs+=( "$file" ) fi done for dir in ${dirs[@]} do createGeneric $dir done #Now list all files, including newly created .all files: if [ -f $1.all ] then rm $1.all fi dir=`basename $1` for file in "$1"/* do if [ -f "$file" ] && ( [ "${file##*.}" == "h" ] || [ "${file##*.}" == "all" ] ) then file=`basename $file` echo "#include \"$dir/$file\"" >> $1.all fi done; } # Actualize .all files createGeneric %{_prefix}/include/Bpp exit 0 %preun -n libbpp-seq-omics-devel removeGeneric() { if [ -f $1.all ] then echo "-- Remove generic include file: $1.all" rm $1.all fi for file in "$1"/* do if [ -d "$file" ] then # Recursion: removeGeneric $file fi done } # Actualize .all files removeGeneric %{_prefix}/include/Bpp exit 0 %postun -n libbpp-seq-omics1 -p /sbin/ldconfig %postun -n libbpp-seq-omics-devel createGeneric() { echo "-- Creating generic include file: $1.all" #Make sure we run into subdirectories first: dirs=() for file in "$1"/* do if [ -d "$file" ] then # Recursion: dirs+=( "$file" ) fi done for dir in ${dirs[@]} do createGeneric $dir done #Now list all files, including newly created .all files: if [ -f $1.all ] then rm $1.all fi dir=`basename $1` for file in "$1"/* do if [ -f "$file" ] && ( [ "${file##*.}" == "h" ] || [ "${file##*.}" == "all" ] ) then file=`basename $file` echo "#include \"$dir/$file\"" >> $1.all fi done; } # Actualize .all files createGeneric %{_prefix}/include/Bpp exit 0 %files -n libbpp-seq-omics1 %defattr(-,root,root) %doc AUTHORS.txt COPYING.txt INSTALL.txt ChangeLog %{_prefix}/%{_lib}/lib*.so.* %files -n libbpp-seq-omics-devel %defattr(-,root,root) %doc AUTHORS.txt COPYING.txt INSTALL.txt ChangeLog %{_prefix}/%{_lib}/lib*.so %{_prefix}/%{_lib}/lib*.a %{_prefix}/include/* %changelog * Mon Sep 22 2014 Julien Dutheil 2.2.0-1 - New statistics, including sequence diversity estimators - Several bugs and memory leaks fixed. * Wed Mar 06 2013 Julien Dutheil 2.1.0-1 - Maf to VCF tool added as a MafIterator. * Tue Nov 06 2012 Julien Dutheil 2.0.3-1 - First draft of the spec file bpp-seq-omics-2.2.0/COPYING.txt000664 001750 001750 00000051140 12372454303 017533 0ustar00jdutheiljdutheil000000 000000 CeCILL FREE SOFTWARE LICENSE AGREEMENT Notice This Agreement is a Free Software license agreement that is the result of discussions between its authors in order to ensure compliance with the two main principles guiding its drafting: * firstly, compliance with the principles governing the distribution of Free Software: access to source code, broad rights granted to users, * secondly, the election of a governing law, French law, with which it is conformant, both as regards the law of torts and intellectual property law, and the protection that it offers to both authors and holders of the economic rights over software. The authors of the CeCILL (for Ce[a] C[nrs] I[nria] L[logiciel] L[ibre]) license are: Commissariat à l'Energie Atomique - CEA, a public scientific, technical and industrial establishment, having its principal place of business at 31-33 rue de la Fédération, 75752 Paris cedex 15, France. Centre National de la Recherche Scientifique - CNRS, a public scientific and technological establishment, having its principal place of business at 3 rue Michel-Ange 75794 Paris cedex 16, France. Institut National de Recherche en Informatique et en Automatique - INRIA, a public scientific and technological establishment, having its principal place of business at Domaine de Voluceau, Rocquencourt, BP 105, 78153 Le Chesnay cedex, France. Preamble The purpose of this Free Software license agreement is to grant users the right to modify and redistribute the software governed by this license within the framework of an open source distribution model. The exercising of these rights is conditional upon certain obligations for users so as to preserve this status for all subsequent redistributions. In consideration of access to the source code and the rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors only have limited liability. In this respect, the risks associated with loading, using, modifying and/or developing or reproducing the software by the user are brought to the user's attention, given its Free Software status, which may make it complicated to use, with the result that its use is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the Software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions of security. This Agreement may be freely reproduced and published, provided it is not altered, and that no provisions are either added or removed herefrom. This Agreement may apply to any or all software for which the holder of the economic rights decides to submit the use thereof to its provisions. Article 1 - DEFINITIONS For the purpose of this Agreement, when the following expressions commence with a capital letter, they shall have the following meaning: Agreement: means this license agreement, and its possible subsequent versions and annexes. Software: means the software in its Object Code and/or Source Code form and, where applicable, its documentation, "as is" when the Licensee accepts the Agreement. Initial Software: means the Software in its Source Code and possibly its Object Code form and, where applicable, its documentation, "as is" when it is first distributed under the terms and conditions of the Agreement. Modified Software: means the Software modified by at least one Contribution. Source Code: means all the Software's instructions and program lines to which access is required so as to modify the Software. Object Code: means the binary files originating from the compilation of the Source Code. Holder: means the holder(s) of the economic rights over the Initial Software. Licensee: means the Software user(s) having accepted the Agreement. Contributor: means a Licensee having made at least one Contribution. Licensor: means the Holder, or any other individual or legal entity, who distributes the Software under the Agreement. Contribution: means any or all modifications, corrections, translations, adaptations and/or new functions integrated into the Software by any or all Contributors, as well as any or all Internal Modules. Module: means a set of sources files including their documentation that enables supplementary functions or services in addition to those offered by the Software. External Module: means any or all Modules, not derived from the Software, so that this Module and the Software run in separate address spaces, with one calling the other when they are run. Internal Module: means any or all Module, connected to the Software so that they both execute in the same address space. GNU GPL: means the GNU General Public License version 2 or any subsequent version, as published by the Free Software Foundation Inc. Parties: mean both the Licensee and the Licensor. These expressions may be used both in singular and plural form. Article 2 - PURPOSE The purpose of the Agreement is the grant by the Licensor to the Licensee of a non-exclusive, transferable and worldwide license for the Software as set forth in Article 5 hereinafter for the whole term of the protection granted by the rights over said Software. Article 3 - ACCEPTANCE 3.1 The Licensee shall be deemed as having accepted the terms and conditions of this Agreement upon the occurrence of the first of the following events: * (i) loading the Software by any or all means, notably, by downloading from a remote server, or by loading from a physical medium; * (ii) the first time the Licensee exercises any of the rights granted hereunder. 3.2 One copy of the Agreement, containing a notice relating to the characteristics of the Software, to the limited warranty, and to the fact that its use is restricted to experienced users has been provided to the Licensee prior to its acceptance as set forth in Article 3.1 hereinabove, and the Licensee hereby acknowledges that it has read and understood it. Article 4 - EFFECTIVE DATE AND TERM 4.1 EFFECTIVE DATE The Agreement shall become effective on the date when it is accepted by the Licensee as set forth in Article 3.1. 4.2 TERM The Agreement shall remain in force for the entire legal term of protection of the economic rights over the Software. Article 5 - SCOPE OF RIGHTS GRANTED The Licensor hereby grants to the Licensee, who accepts, the following rights over the Software for any or all use, and for the term of the Agreement, on the basis of the terms and conditions set forth hereinafter. Besides, if the Licensor owns or comes to own one or more patents protecting all or part of the functions of the Software or of its components, the Licensor undertakes not to enforce the rights granted by these patents against successive Licensees using, exploiting or modifying the Software. If these patents are transferred, the Licensor undertakes to have the transferees subscribe to the obligations set forth in this paragraph. 5.1 RIGHT OF USE The Licensee is authorized to use the Software, without any limitation as to its fields of application, with it being hereinafter specified that this comprises: 1. permanent or temporary reproduction of all or part of the Software by any or all means and in any or all form. 2. loading, displaying, running, or storing the Software on any or all medium. 3. entitlement to observe, study or test its operation so as to determine the ideas and principles behind any or all constituent elements of said Software. This shall apply when the Licensee carries out any or all loading, displaying, running, transmission or storage operation as regards the Software, that it is entitled to carry out hereunder. 5.2 ENTITLEMENT TO MAKE CONTRIBUTIONS The right to make Contributions includes the right to translate, adapt, arrange, or make any or all modifications to the Software, and the right to reproduce the resulting Software. The Licensee is authorized to make any or all Contributions to the Software provided that it includes an explicit notice that it is the author of said Contribution and indicates the date of the creation thereof. 5.3 RIGHT OF DISTRIBUTION In particular, the right of distribution includes the right to publish, transmit and communicate the Software to the general public on any or all medium, and by any or all means, and the right to market, either in consideration of a fee, or free of charge, one or more copies of the Software by any means. The Licensee is further authorized to distribute copies of the modified or unmodified Software to third parties according to the terms and conditions set forth hereinafter. 5.3.1 DISTRIBUTION OF SOFTWARE WITHOUT MODIFICATION The Licensee is authorized to distribute true copies of the Software in Source Code or Object Code form, provided that said distribution complies with all the provisions of the Agreement and is accompanied by: 1. a copy of the Agreement, 2. a notice relating to the limitation of both the Licensor's warranty and liability as set forth in Articles 8 and 9, and that, in the event that only the Object Code of the Software is redistributed, the Licensee allows future Licensees unhindered access to the full Source Code of the Software by indicating how to access it, it being understood that the additional cost of acquiring the Source Code shall not exceed the cost of transferring the data. 5.3.2 DISTRIBUTION OF MODIFIED SOFTWARE When the Licensee makes a Contribution to the Software, the terms and conditions for the distribution of the Modified Software become subject to all the provisions of this Agreement. The Licensee is authorized to distribute the Modified Software, in Source Code or Object Code form, provided that said distribution complies with all the provisions of the Agreement and is accompanied by: 1. a copy of the Agreement, 2. a notice relating to the limitation of both the Licensor's warranty and liability as set forth in Articles 8 and 9, and that, in the event that only the Object Code of the Modified Software is redistributed, the Licensee allows future Licensees unhindered access to the full Source Code of the Modified Software by indicating how to access it, it being understood that the additional cost of acquiring the Source Code shall not exceed the cost of transferring the data. 5.3.3 DISTRIBUTION OF EXTERNAL MODULES When the Licensee has developed an External Module, the terms and conditions of this Agreement do not apply to said External Module, that may be distributed under a separate license agreement. 5.3.4 COMPATIBILITY WITH THE GNU GPL The Licensee can include a code that is subject to the provisions of one of the versions of the GNU GPL in the Modified or unmodified Software, and distribute that entire code under the terms of the same version of the GNU GPL. The Licensee can include the Modified or unmodified Software in a code that is subject to the provisions of one of the versions of the GNU GPL, and distribute that entire code under the terms of the same version of the GNU GPL. Article 6 - INTELLECTUAL PROPERTY 6.1 OVER THE INITIAL SOFTWARE The Holder owns the economic rights over the Initial Software. Any or all use of the Initial Software is subject to compliance with the terms and conditions under which the Holder has elected to distribute its work and no one shall be entitled to modify the terms and conditions for the distribution of said Initial Software. The Holder undertakes that the Initial Software will remain ruled at least by the current license, for the duration set forth in article 4.2. 6.2 OVER THE CONTRIBUTIONS A Licensee who develops a Contribution is the owner of the intellectual property rights over this Contribution as defined by applicable law. 6.3 OVER THE EXTERNAL MODULES A Licensee who develops an External Module is the owner of the intellectual property rights over this External Module as defined by applicable law and is free to choose the type of agreement that shall govern its distribution. 6.4 JOINT PROVISIONS The Licensee expressly undertakes: 1. not to remove, or modify, in any manner, the intellectual property notices attached to the Software; 2. to reproduce said notices, in an identical manner, in the copies of the Software modified or not. The Licensee undertakes not to directly or indirectly infringe the intellectual property rights of the Holder and/or Contributors on the Software and to take, where applicable, vis-à-vis its staff, any and all measures required to ensure respect of said intellectual property rights of the Holder and/or Contributors. Article 7 - RELATED SERVICES 7.1 Under no circumstances shall the Agreement oblige the Licensor to provide technical assistance or maintenance services for the Software. However, the Licensor is entitled to offer this type of services. The terms and conditions of such technical assistance, and/or such maintenance, shall be set forth in a separate instrument. Only the Licensor offering said maintenance and/or technical assistance services shall incur liability therefor. 7.2 Similarly, any Licensor is entitled to offer to its licensees, under its sole responsibility, a warranty, that shall only be binding upon itself, for the redistribution of the Software and/or the Modified Software, under terms and conditions that it is free to decide. Said warranty, and the financial terms and conditions of its application, shall be subject of a separate instrument executed between the Licensor and the Licensee. Article 8 - LIABILITY 8.1 Subject to the provisions of Article 8.2, the Licensee shall be entitled to claim compensation for any direct loss it may have suffered from the Software as a result of a fault on the part of the relevant Licensor, subject to providing evidence thereof. 8.2 The Licensor's liability is limited to the commitments made under this Agreement and shall not be incurred as a result of in particular: (i) loss due the Licensee's total or partial failure to fulfill its obligations, (ii) direct or consequential loss that is suffered by the Licensee due to the use or performance of the Software, and (iii) more generally, any consequential loss. In particular the Parties expressly agree that any or all pecuniary or business loss (i.e. loss of data, loss of profits, operating loss, loss of customers or orders, opportunity cost, any disturbance to business activities) or any or all legal proceedings instituted against the Licensee by a third party, shall constitute consequential loss and shall not provide entitlement to any or all compensation from the Licensor. Article 9 - WARRANTY 9.1 The Licensee acknowledges that the scientific and technical state-of-the-art when the Software was distributed did not enable all possible uses to be tested and verified, nor for the presence of possible defects to be detected. In this respect, the Licensee's attention has been drawn to the risks associated with loading, using, modifying and/or developing and reproducing the Software which are reserved for experienced users. The Licensee shall be responsible for verifying, by any or all means, the product's suitability for its requirements, its good working order, and for ensuring that it shall not cause damage to either persons or properties. 9.2 The Licensor hereby represents, in good faith, that it is entitled to grant all the rights over the Software (including in particular the rights set forth in Article 5). 9.3 The Licensee acknowledges that the Software is supplied "as is" by the Licensor without any other express or tacit warranty, other than that provided for in Article 9.2 and, in particular, without any warranty as to its commercial value, its secured, safe, innovative or relevant nature. Specifically, the Licensor does not warrant that the Software is free from any error, that it will operate without interruption, that it will be compatible with the Licensee's own equipment and software configuration, nor that it will meet the Licensee's requirements. 9.4 The Licensor does not either expressly or tacitly warrant that the Software does not infringe any third party intellectual property right relating to a patent, software or any other property right. Therefore, the Licensor disclaims any and all liability towards the Licensee arising out of any or all proceedings for infringement that may be instituted in respect of the use, modification and redistribution of the Software. Nevertheless, should such proceedings be instituted against the Licensee, the Licensor shall provide it with technical and legal assistance for its defense. Such technical and legal assistance shall be decided on a case-by-case basis between the relevant Licensor and the Licensee pursuant to a memorandum of understanding. The Licensor disclaims any and all liability as regards the Licensee's use of the name of the Software. No warranty is given as regards the existence of prior rights over the name of the Software or as regards the existence of a trademark. Article 10 - TERMINATION 10.1 In the event of a breach by the Licensee of its obligations hereunder, the Licensor may automatically terminate this Agreement thirty (30) days after notice has been sent to the Licensee and has remained ineffective. 10.2 A Licensee whose Agreement is terminated shall no longer be authorized to use, modify or distribute the Software. However, any licenses that it may have granted prior to termination of the Agreement shall remain valid subject to their having been granted in compliance with the terms and conditions hereof. Article 11 - MISCELLANEOUS 11.1 EXCUSABLE EVENTS Neither Party shall be liable for any or all delay, or failure to perform the Agreement, that may be attributable to an event of force majeure, an act of God or an outside cause, such as defective functioning or interruptions of the electricity or telecommunications networks, network paralysis following a virus attack, intervention by government authorities, natural disasters, water damage, earthquakes, fire, explosions, strikes and labor unrest, war, etc. 11.2 Any Failure by either Party, on one or more occasions, to invoke one or more of the provisions hereof, shall under no circumstances be interpreted as being a waiver by the interested Party of its right to invoke said provision(s) subsequently. 11.3 The Agreement cancels and replaces any or all previous agreements, whether written or oral, between the Parties and having the same purpose, and constitutes the entirety of the agreement between said Parties concerning said purpose. No supplement or modification to the terms and conditions hereof shall be effective as between the Parties unless it is made in writing and signed by their duly authorized representatives. 11.4 In the event that one or more of the provisions hereof were to conflict with a current or future applicable act or legislative text, said act or legislative text shall prevail, and the Parties shall make the necessary amendments so as to comply with said act or legislative text. All other provisions shall remain effective. Similarly, invalidity of a provision of the Agreement, for any reason whatsoever, shall not cause the Agreement as a whole to be invalid. 11.5 LANGUAGE The Agreement is drafted in both French and English and both versions are deemed authentic. Article 12 - NEW VERSIONS OF THE AGREEMENT 12.1 Any person is authorized to duplicate and distribute copies of this Agreement. 12.2 So as to ensure coherence, the wording of this Agreement is protected and may only be modified by the authors of the License, who reserve the right to periodically publish updates or new versions of the Agreement, each with a separate number. These subsequent versions may address new issues encountered by Free Software. 12.3 Any Software distributed under a given version of the Agreement may only be subsequently distributed under the same version of the Agreement or a subsequent version, subject to the provisions of Article 5.3.4. Article 13 - GOVERNING LAW AND JURISDICTION 13.1 The Agreement is governed by French law. The Parties agree to endeavor to seek an amicable solution to any disagreements or disputes that may arise during the performance of the Agreement. 13.2 Failing an amicable solution within two (2) months as from their occurrence, and unless emergency proceedings are necessary, the disagreements or disputes shall be referred to the Paris Courts having jurisdiction, by the more diligent Party. Version 2.0 dated 2005-05-21. bpp-seq-omics-2.2.0/Doxyfile000664 001750 001750 00000240244 12407765612 017404 0ustar00jdutheiljdutheil000000 000000 # Doxyfile 1.8.3.1-20130209 # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, ...] # For lists items can also be appended using: # TAG += value [value, ...] # Values that contain spaces should be placed between quotes (" ") #--------------------------------------------------------------------------- # Project related configuration options #--------------------------------------------------------------------------- # This tag specifies the encoding used for all characters in the config file # that follow. The default is UTF-8 which is also the encoding used for all # text before the first occurrence of this tag. Doxygen uses libiconv (or the # iconv built into libc) for the transcoding. See # http://www.gnu.org/software/libiconv for the list of possible encodings. DOXYFILE_ENCODING = UTF-8 # The PROJECT_NAME tag is a single word (or sequence of words) that should # identify the project. Note that if you do not use Doxywizard you need # to put quotes around the project name if it contains spaces. PROJECT_NAME = bpp-seq-omics # The PROJECT_NUMBER tag can be used to enter a project or revision number. # This could be handy for archiving the generated documentation or # if some version control system is used. PROJECT_NUMBER = 2.2.0 # Using the PROJECT_BRIEF tag one can provide an optional one line description # for a project that appears at the top of each page and should give viewer # a quick idea about the purpose of the project. Keep the description short. PROJECT_BRIEF = # With the PROJECT_LOGO tag one can specify an logo or icon that is # included in the documentation. The maximum height of the logo should not # exceed 55 pixels and the maximum width should not exceed 200 pixels. # Doxygen will copy the logo to the output directory. PROJECT_LOGO = # The OUTPUT_DIRECTORY tag is used to specify the (relative or absolute) # base path where the generated documentation will be put. # If a relative path is entered, it will be relative to the location # where doxygen was started. If left blank the current directory will be used. OUTPUT_DIRECTORY = # If the CREATE_SUBDIRS tag is set to YES, then doxygen will create # 4096 sub-directories (in 2 levels) under the output directory of each output # format and will distribute the generated files over these directories. # Enabling this option can be useful when feeding doxygen a huge amount of # source files, where putting all generated files in the same directory would # otherwise cause performance problems for the file system. CREATE_SUBDIRS = NO # The OUTPUT_LANGUAGE tag is used to specify the language in which all # documentation generated by doxygen is written. Doxygen will use this # information to generate all constant output in the proper language. # The default language is English, other supported languages are: # Afrikaans, Arabic, Brazilian, Catalan, Chinese, Chinese-Traditional, # Croatian, Czech, Danish, Dutch, Esperanto, Farsi, Finnish, French, German, # Greek, Hungarian, Italian, Japanese, Japanese-en (Japanese with English # messages), Korean, Korean-en, Latvian, Lithuanian, Norwegian, Macedonian, Persian, # Polish, Portuguese, Romanian, Russian, Serbian, Serbian-Cyrillic, Slovak, # Slovene, Spanish, Swedish, Ukrainian, and Vietnamese. OUTPUT_LANGUAGE = English # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). # Set to NO to disable this. BRIEF_MEMBER_DESC = YES # If the REPEAT_BRIEF tag is set to YES (the default) Doxygen will prepend # the brief description of a member or function before the detailed description. # Note: if both HIDE_UNDOC_MEMBERS and BRIEF_MEMBER_DESC are set to NO, the # brief descriptions will be completely suppressed. REPEAT_BRIEF = YES # This tag implements a quasi-intelligent brief description abbreviator # that is used to form the text in various listings. Each string # in this list, if found as the leading text of the brief description, will be # stripped from the text and the result after processing the whole list, is # used as the annotated text. Otherwise, the brief description is used as-is. # If left blank, the following values are used ("$name" is automatically # replaced with the name of the entity): "The $name class" "The $name widget" # "The $name file" "is" "provides" "specifies" "contains" # "represents" "a" "an" "the" ABBREVIATE_BRIEF = # If the ALWAYS_DETAILED_SEC and REPEAT_BRIEF tags are both set to YES then # Doxygen will generate a detailed section even if there is only a brief # description. ALWAYS_DETAILED_SEC = NO # If the INLINE_INHERITED_MEMB tag is set to YES, doxygen will show all # inherited members of a class in the documentation of that class as if those # members were ordinary class members. Constructors, destructors and assignment # operators of the base classes will not be shown. INLINE_INHERITED_MEMB = YES # If the FULL_PATH_NAMES tag is set to YES then Doxygen will prepend the full # path before files name in the file list and in the header files. If set # to NO the shortest path that makes the file name unique will be used. FULL_PATH_NAMES = YES # If the FULL_PATH_NAMES tag is set to YES then the STRIP_FROM_PATH tag # can be used to strip a user-defined part of the path. Stripping is # only done if one of the specified strings matches the left-hand part of # the path. The tag can be used to show relative paths in the file list. # If left blank the directory from which doxygen is run is used as the # path to strip. Note that you specify absolute paths here, but also # relative paths, which will be relative from the directory where doxygen is # started. STRIP_FROM_PATH = ./src/ # The STRIP_FROM_INC_PATH tag can be used to strip a user-defined part of # the path mentioned in the documentation of a class, which tells # the reader which header file to include in order to use a class. # If left blank only the name of the header file containing the class # definition is used. Otherwise one should specify the include paths that # are normally passed to the compiler using the -I flag. STRIP_FROM_INC_PATH = ./src/ # If the SHORT_NAMES tag is set to YES, doxygen will generate much shorter # (but less readable) file names. This can be useful if your file system # doesn't support long names like on DOS, Mac, or CD-ROM. SHORT_NAMES = NO # If the JAVADOC_AUTOBRIEF tag is set to YES then Doxygen # will interpret the first line (until the first dot) of a JavaDoc-style # comment as the brief description. If set to NO, the JavaDoc # comments will behave just like regular Qt-style comments # (thus requiring an explicit @brief command for a brief description.) JAVADOC_AUTOBRIEF = NO # If the QT_AUTOBRIEF tag is set to YES then Doxygen will # interpret the first line (until the first dot) of a Qt-style # comment as the brief description. If set to NO, the comments # will behave just like regular Qt-style comments (thus requiring # an explicit \brief command for a brief description.) QT_AUTOBRIEF = NO # The MULTILINE_CPP_IS_BRIEF tag can be set to YES to make Doxygen # treat a multi-line C++ special comment block (i.e. a block of //! or /// # comments) as a brief description. This used to be the default behaviour. # The new default is to treat a multi-line C++ comment block as a detailed # description. Set this tag to YES if you prefer the old behaviour instead. MULTILINE_CPP_IS_BRIEF = NO # If the INHERIT_DOCS tag is set to YES (the default) then an undocumented # member inherits the documentation from any documented member that it # re-implements. INHERIT_DOCS = YES # If the SEPARATE_MEMBER_PAGES tag is set to YES, then doxygen will produce # a new page for each member. If set to NO, the documentation of a member will # be part of the file/class/namespace that contains it. SEPARATE_MEMBER_PAGES = NO # The TAB_SIZE tag can be used to set the number of spaces in a tab. # Doxygen uses this value to replace tabs by spaces in code fragments. TAB_SIZE = 2 # This tag can be used to specify a number of aliases that acts # as commands in the documentation. An alias has the form "name=value". # For example adding "sideeffect=\par Side Effects:\n" will allow you to # put the command \sideeffect (or @sideeffect) in the documentation, which # will result in a user-defined paragraph with heading "Side Effects:". # You can put \n's in the value part of an alias to insert newlines. ALIASES = # This tag can be used to specify a number of word-keyword mappings (TCL only). # A mapping has the form "name=value". For example adding # "class=itcl::class" will allow you to use the command class in the # itcl::class meaning. TCL_SUBST = # Set the OPTIMIZE_OUTPUT_FOR_C tag to YES if your project consists of C # sources only. Doxygen will then generate output that is more tailored for C. # For instance, some of the names that are used will be different. The list # of all members will be omitted, etc. OPTIMIZE_OUTPUT_FOR_C = NO # Set the OPTIMIZE_OUTPUT_JAVA tag to YES if your project consists of Java # sources only. Doxygen will then generate output that is more tailored for # Java. For instance, namespaces will be presented as packages, qualified # scopes will look different, etc. OPTIMIZE_OUTPUT_JAVA = NO # Set the OPTIMIZE_FOR_FORTRAN tag to YES if your project consists of Fortran # sources only. Doxygen will then generate output that is more tailored for # Fortran. OPTIMIZE_FOR_FORTRAN = NO # Set the OPTIMIZE_OUTPUT_VHDL tag to YES if your project consists of VHDL # sources. Doxygen will then generate output that is tailored for # VHDL. OPTIMIZE_OUTPUT_VHDL = NO # Doxygen selects the parser to use depending on the extension of the files it # parses. With this tag you can assign which parser to use for a given # extension. Doxygen has a built-in mapping, but you can override or extend it # using this tag. The format is ext=language, where ext is a file extension, # and language is one of the parsers supported by doxygen: IDL, Java, # Javascript, CSharp, C, C++, D, PHP, Objective-C, Python, Fortran, VHDL, C, # C++. For instance to make doxygen treat .inc files as Fortran files (default # is PHP), and .f files as C (default is Fortran), use: inc=Fortran f=C. Note # that for custom extensions you also need to set FILE_PATTERNS otherwise the # files are not read by doxygen. EXTENSION_MAPPING = # If MARKDOWN_SUPPORT is enabled (the default) then doxygen pre-processes all # comments according to the Markdown format, which allows for more readable # documentation. See http://daringfireball.net/projects/markdown/ for details. # The output of markdown processing is further processed by doxygen, so you # can mix doxygen, HTML, and XML commands with Markdown formatting. # Disable only in case of backward compatibilities issues. MARKDOWN_SUPPORT = YES # When enabled doxygen tries to link words that correspond to documented classes, # or namespaces to their corresponding documentation. Such a link can be # prevented in individual cases by by putting a % sign in front of the word or # globally by setting AUTOLINK_SUPPORT to NO. AUTOLINK_SUPPORT = YES # If you use STL classes (i.e. std::string, std::vector, etc.) but do not want # to include (a tag file for) the STL sources as input, then you should # set this tag to YES in order to let doxygen match functions declarations and # definitions whose arguments contain STL classes (e.g. func(std::string); v.s. # func(std::string) {}). This also makes the inheritance and collaboration # diagrams that involve STL classes more complete and accurate. BUILTIN_STL_SUPPORT = YES # If you use Microsoft's C++/CLI language, you should set this option to YES to # enable parsing support. CPP_CLI_SUPPORT = NO # Set the SIP_SUPPORT tag to YES if your project consists of sip sources only. # Doxygen will parse them like normal C++ but will assume all classes use public # instead of private inheritance when no explicit protection keyword is present. SIP_SUPPORT = NO # For Microsoft's IDL there are propget and propput attributes to indicate # getter and setter methods for a property. Setting this option to YES (the # default) will make doxygen replace the get and set methods by a property in # the documentation. This will only work if the methods are indeed getting or # setting a simple type. If this is not the case, or you want to show the # methods anyway, you should set this option to NO. IDL_PROPERTY_SUPPORT = YES # If member grouping is used in the documentation and the DISTRIBUTE_GROUP_DOC # tag is set to YES, then doxygen will reuse the documentation of the first # member in the group (if any) for the other members of the group. By default # all members of a group must be documented explicitly. DISTRIBUTE_GROUP_DOC = NO # Set the SUBGROUPING tag to YES (the default) to allow class member groups of # the same type (for instance a group of public functions) to be put as a # subgroup of that type (e.g. under the Public Functions section). Set it to # NO to prevent subgrouping. Alternatively, this can be done per class using # the \nosubgrouping command. SUBGROUPING = YES # When the INLINE_GROUPED_CLASSES tag is set to YES, classes, structs and # unions are shown inside the group in which they are included (e.g. using # @ingroup) instead of on a separate page (for HTML and Man pages) or # section (for LaTeX and RTF). INLINE_GROUPED_CLASSES = NO # When the INLINE_SIMPLE_STRUCTS tag is set to YES, structs, classes, and # unions with only public data fields or simple typedef fields will be shown # inline in the documentation of the scope in which they are defined (i.e. file, # namespace, or group documentation), provided this scope is documented. If set # to NO (the default), structs, classes, and unions are shown on a separate # page (for HTML and Man pages) or section (for LaTeX and RTF). INLINE_SIMPLE_STRUCTS = NO # When TYPEDEF_HIDES_STRUCT is enabled, a typedef of a struct, union, or enum # is documented as struct, union, or enum with the name of the typedef. So # typedef struct TypeS {} TypeT, will appear in the documentation as a struct # with name TypeT. When disabled the typedef will appear as a member of a file, # namespace, or class. And the struct will be named TypeS. This can typically # be useful for C code in case the coding convention dictates that all compound # types are typedef'ed and only the typedef is referenced, never the tag name. TYPEDEF_HIDES_STRUCT = NO # The SYMBOL_CACHE_SIZE determines the size of the internal cache use to # determine which symbols to keep in memory and which to flush to disk. # When the cache is full, less often used symbols will be written to disk. # For small to medium size projects (<1000 input files) the default value is # probably good enough. For larger projects a too small cache size can cause # doxygen to be busy swapping symbols to and from disk most of the time # causing a significant performance penalty. # If the system has enough physical memory increasing the cache will improve the # performance by keeping more symbols in memory. Note that the value works on # a logarithmic scale so increasing the size by one will roughly double the # memory usage. The cache size is given by this formula: # 2^(16+SYMBOL_CACHE_SIZE). The valid range is 0..9, the default is 0, # corresponding to a cache size of 2^16 = 65536 symbols. SYMBOL_CACHE_SIZE = 0 # Similar to the SYMBOL_CACHE_SIZE the size of the symbol lookup cache can be # set using LOOKUP_CACHE_SIZE. This cache is used to resolve symbols given # their name and scope. Since this can be an expensive process and often the # same symbol appear multiple times in the code, doxygen keeps a cache of # pre-resolved symbols. If the cache is too small doxygen will become slower. # If the cache is too large, memory is wasted. The cache size is given by this # formula: 2^(16+LOOKUP_CACHE_SIZE). The valid range is 0..9, the default is 0, # corresponding to a cache size of 2^16 = 65536 symbols. LOOKUP_CACHE_SIZE = 0 #--------------------------------------------------------------------------- # Build related configuration options #--------------------------------------------------------------------------- # If the EXTRACT_ALL tag is set to YES doxygen will assume all entities in # documentation are documented, even if no documentation was available. # Private class members and static file members will be hidden unless # the EXTRACT_PRIVATE and EXTRACT_STATIC tags are set to YES EXTRACT_ALL = YES # If the EXTRACT_PRIVATE tag is set to YES all private members of a class # will be included in the documentation. EXTRACT_PRIVATE = YES # If the EXTRACT_PACKAGE tag is set to YES all members with package or internal # scope will be included in the documentation. EXTRACT_PACKAGE = NO # If the EXTRACT_STATIC tag is set to YES all static members of a file # will be included in the documentation. EXTRACT_STATIC = YES # If the EXTRACT_LOCAL_CLASSES tag is set to YES classes (and structs) # defined locally in source files will be included in the documentation. # If set to NO only classes defined in header files are included. EXTRACT_LOCAL_CLASSES = YES # This flag is only useful for Objective-C code. When set to YES local # methods, which are defined in the implementation section but not in # the interface are included in the documentation. # If set to NO (the default) only methods in the interface are included. EXTRACT_LOCAL_METHODS = NO # If this flag is set to YES, the members of anonymous namespaces will be # extracted and appear in the documentation as a namespace called # 'anonymous_namespace{file}', where file will be replaced with the base # name of the file that contains the anonymous namespace. By default # anonymous namespaces are hidden. EXTRACT_ANON_NSPACES = NO # If the HIDE_UNDOC_MEMBERS tag is set to YES, Doxygen will hide all # undocumented members of documented classes, files or namespaces. # If set to NO (the default) these members will be included in the # various overviews, but no documentation section is generated. # This option has no effect if EXTRACT_ALL is enabled. HIDE_UNDOC_MEMBERS = NO # If the HIDE_UNDOC_CLASSES tag is set to YES, Doxygen will hide all # undocumented classes that are normally visible in the class hierarchy. # If set to NO (the default) these classes will be included in the various # overviews. This option has no effect if EXTRACT_ALL is enabled. HIDE_UNDOC_CLASSES = NO # If the HIDE_FRIEND_COMPOUNDS tag is set to YES, Doxygen will hide all # friend (class|struct|union) declarations. # If set to NO (the default) these declarations will be included in the # documentation. HIDE_FRIEND_COMPOUNDS = NO # If the HIDE_IN_BODY_DOCS tag is set to YES, Doxygen will hide any # documentation blocks found inside the body of a function. # If set to NO (the default) these blocks will be appended to the # function's detailed documentation block. HIDE_IN_BODY_DOCS = NO # The INTERNAL_DOCS tag determines if documentation # that is typed after a \internal command is included. If the tag is set # to NO (the default) then the documentation will be excluded. # Set it to YES to include the internal documentation. INTERNAL_DOCS = NO # If the CASE_SENSE_NAMES tag is set to NO then Doxygen will only generate # file names in lower-case letters. If set to YES upper-case letters are also # allowed. This is useful if you have classes or files whose names only differ # in case and if your file system supports case sensitive file names. Windows # and Mac users are advised to set this option to NO. CASE_SENSE_NAMES = YES # If the HIDE_SCOPE_NAMES tag is set to NO (the default) then Doxygen # will show members with their full class and namespace scopes in the # documentation. If set to YES the scope will be hidden. HIDE_SCOPE_NAMES = NO # If the SHOW_INCLUDE_FILES tag is set to YES (the default) then Doxygen # will put a list of the files that are included by a file in the documentation # of that file. SHOW_INCLUDE_FILES = YES # If the FORCE_LOCAL_INCLUDES tag is set to YES then Doxygen # will list include files with double quotes in the documentation # rather than with sharp brackets. FORCE_LOCAL_INCLUDES = NO # If the INLINE_INFO tag is set to YES (the default) then a tag [inline] # is inserted in the documentation for inline members. INLINE_INFO = YES # If the SORT_MEMBER_DOCS tag is set to YES (the default) then doxygen # will sort the (detailed) documentation of file and class members # alphabetically by member name. If set to NO the members will appear in # declaration order. SORT_MEMBER_DOCS = YES # If the SORT_BRIEF_DOCS tag is set to YES then doxygen will sort the # brief documentation of file, namespace and class members alphabetically # by member name. If set to NO (the default) the members will appear in # declaration order. SORT_BRIEF_DOCS = NO # If the SORT_MEMBERS_CTORS_1ST tag is set to YES then doxygen # will sort the (brief and detailed) documentation of class members so that # constructors and destructors are listed first. If set to NO (the default) # the constructors will appear in the respective orders defined by # SORT_MEMBER_DOCS and SORT_BRIEF_DOCS. # This tag will be ignored for brief docs if SORT_BRIEF_DOCS is set to NO # and ignored for detailed docs if SORT_MEMBER_DOCS is set to NO. SORT_MEMBERS_CTORS_1ST = NO # If the SORT_GROUP_NAMES tag is set to YES then doxygen will sort the # hierarchy of group names into alphabetical order. If set to NO (the default) # the group names will appear in their defined order. SORT_GROUP_NAMES = NO # If the SORT_BY_SCOPE_NAME tag is set to YES, the class list will be # sorted by fully-qualified names, including namespaces. If set to # NO (the default), the class list will be sorted only by class name, # not including the namespace part. # Note: This option is not very useful if HIDE_SCOPE_NAMES is set to YES. # Note: This option applies only to the class list, not to the # alphabetical list. SORT_BY_SCOPE_NAME = NO # If the STRICT_PROTO_MATCHING option is enabled and doxygen fails to # do proper type resolution of all parameters of a function it will reject a # match between the prototype and the implementation of a member function even # if there is only one candidate or it is obvious which candidate to choose # by doing a simple string match. By disabling STRICT_PROTO_MATCHING doxygen # will still accept a match between prototype and implementation in such cases. STRICT_PROTO_MATCHING = NO # The GENERATE_TODOLIST tag can be used to enable (YES) or # disable (NO) the todo list. This list is created by putting \todo # commands in the documentation. GENERATE_TODOLIST = YES # The GENERATE_TESTLIST tag can be used to enable (YES) or # disable (NO) the test list. This list is created by putting \test # commands in the documentation. GENERATE_TESTLIST = NO # The GENERATE_BUGLIST tag can be used to enable (YES) or # disable (NO) the bug list. This list is created by putting \bug # commands in the documentation. GENERATE_BUGLIST = NO # The GENERATE_DEPRECATEDLIST tag can be used to enable (YES) or # disable (NO) the deprecated list. This list is created by putting # \deprecated commands in the documentation. GENERATE_DEPRECATEDLIST= YES # The ENABLED_SECTIONS tag can be used to enable conditional # documentation sections, marked by \if section-label ... \endif # and \cond section-label ... \endcond blocks. ENABLED_SECTIONS = # The MAX_INITIALIZER_LINES tag determines the maximum number of lines # the initial value of a variable or macro consists of for it to appear in # the documentation. If the initializer consists of more lines than specified # here it will be hidden. Use a value of 0 to hide initializers completely. # The appearance of the initializer of individual variables and macros in the # documentation can be controlled using \showinitializer or \hideinitializer # command in the documentation regardless of this setting. MAX_INITIALIZER_LINES = 30 # Set the SHOW_USED_FILES tag to NO to disable the list of files generated # at the bottom of the documentation of classes and structs. If set to YES the # list will mention the files that were used to generate the documentation. SHOW_USED_FILES = YES # Set the SHOW_FILES tag to NO to disable the generation of the Files page. # This will remove the Files entry from the Quick Index and from the # Folder Tree View (if specified). The default is YES. SHOW_FILES = YES # Set the SHOW_NAMESPACES tag to NO to disable the generation of the # Namespaces page. This will remove the Namespaces entry from the Quick Index # and from the Folder Tree View (if specified). The default is YES. SHOW_NAMESPACES = YES # The FILE_VERSION_FILTER tag can be used to specify a program or script that # doxygen should invoke to get the current version for each file (typically from # the version control system). Doxygen will invoke the program by executing (via # popen()) the command , where is the value of # the FILE_VERSION_FILTER tag, and is the name of an input file # provided by doxygen. Whatever the program writes to standard output # is used as the file version. See the manual for examples. FILE_VERSION_FILTER = # The LAYOUT_FILE tag can be used to specify a layout file which will be parsed # by doxygen. The layout file controls the global structure of the generated # output files in an output format independent way. To create the layout file # that represents doxygen's defaults, run doxygen with the -l option. # You can optionally specify a file name after the option, if omitted # DoxygenLayout.xml will be used as the name of the layout file. LAYOUT_FILE = # The CITE_BIB_FILES tag can be used to specify one or more bib files # containing the references data. This must be a list of .bib files. The # .bib extension is automatically appended if omitted. Using this command # requires the bibtex tool to be installed. See also # http://en.wikipedia.org/wiki/BibTeX for more info. For LaTeX the style # of the bibliography can be controlled using LATEX_BIB_STYLE. To use this # feature you need bibtex and perl available in the search path. Do not use # file names with spaces, bibtex cannot handle them. CITE_BIB_FILES = #--------------------------------------------------------------------------- # configuration options related to warning and progress messages #--------------------------------------------------------------------------- # The QUIET tag can be used to turn on/off the messages that are generated # by doxygen. Possible values are YES and NO. If left blank NO is used. QUIET = NO # The WARNINGS tag can be used to turn on/off the warning messages that are # generated by doxygen. Possible values are YES and NO. If left blank # NO is used. WARNINGS = YES # If WARN_IF_UNDOCUMENTED is set to YES, then doxygen will generate warnings # for undocumented members. If EXTRACT_ALL is set to YES then this flag will # automatically be disabled. WARN_IF_UNDOCUMENTED = YES # If WARN_IF_DOC_ERROR is set to YES, doxygen will generate warnings for # potential errors in the documentation, such as not documenting some # parameters in a documented function, or documenting parameters that # don't exist or using markup commands wrongly. WARN_IF_DOC_ERROR = YES # The WARN_NO_PARAMDOC option can be enabled to get warnings for # functions that are documented, but have no documentation for their parameters # or return value. If set to NO (the default) doxygen will only warn about # wrong or incomplete parameter documentation, but not about the absence of # documentation. WARN_NO_PARAMDOC = NO # The WARN_FORMAT tag determines the format of the warning messages that # doxygen can produce. The string should contain the $file, $line, and $text # tags, which will be replaced by the file and line number from which the # warning originated and the warning text. Optionally the format may contain # $version, which will be replaced by the version of the file (if it could # be obtained via FILE_VERSION_FILTER) WARN_FORMAT = "$file:$line: $text" # The WARN_LOGFILE tag can be used to specify a file to which warning # and error messages should be written. If left blank the output is written # to stderr. WARN_LOGFILE = #--------------------------------------------------------------------------- # configuration options related to the input files #--------------------------------------------------------------------------- # The INPUT tag can be used to specify the files and/or directories that contain # documented source files. You may enter file names like "myfile.cpp" or # directories like "/usr/src/myproject". Separate the files or directories # with spaces. INPUT = src # This tag can be used to specify the character encoding of the source files # that doxygen parses. Internally doxygen uses the UTF-8 encoding, which is # also the default input encoding. Doxygen uses libiconv (or the iconv built # into libc) for the transcoding. See http://www.gnu.org/software/libiconv for # the list of possible encodings. INPUT_ENCODING = UTF-8 # If the value of the INPUT tag contains directories, you can use the # FILE_PATTERNS tag to specify one or more wildcard pattern (like *.cpp # and *.h) to filter out the source-files in the directories. If left # blank the following patterns are tested: # *.c *.cc *.cxx *.cpp *.c++ *.d *.java *.ii *.ixx *.ipp *.i++ *.inl *.h *.hh # *.hxx *.hpp *.h++ *.idl *.odl *.cs *.php *.php3 *.inc *.m *.mm *.dox *.py # *.f90 *.f *.for *.vhd *.vhdl FILE_PATTERNS = *.h \ *.cpp # The RECURSIVE tag can be used to turn specify whether or not subdirectories # should be searched for input files as well. Possible values are YES and NO. # If left blank NO is used. RECURSIVE = YES # The EXCLUDE tag can be used to specify files and/or directories that should be # excluded from the INPUT source files. This way you can easily exclude a # subdirectory from a directory tree whose root is specified with the INPUT tag. # Note that relative paths are relative to the directory from which doxygen is # run. EXCLUDE = # The EXCLUDE_SYMLINKS tag can be used to select whether or not files or # directories that are symbolic links (a Unix file system feature) are excluded # from the input. EXCLUDE_SYMLINKS = NO # If the value of the INPUT tag contains directories, you can use the # EXCLUDE_PATTERNS tag to specify one or more wildcard patterns to exclude # certain files from those directories. Note that the wildcards are matched # against the file with absolute path, so to exclude all test directories # for example use the pattern */test/* EXCLUDE_PATTERNS = # The EXCLUDE_SYMBOLS tag can be used to specify one or more symbol names # (namespaces, classes, functions, etc.) that should be excluded from the # output. The symbol name can be a fully qualified name, a word, or if the # wildcard * is used, a substring. Examples: ANamespace, AClass, # AClass::ANamespace, ANamespace::*Test EXCLUDE_SYMBOLS = # The EXAMPLE_PATH tag can be used to specify one or more files or # directories that contain example code fragments that are included (see # the \include command). EXAMPLE_PATH = # If the value of the EXAMPLE_PATH tag contains directories, you can use the # EXAMPLE_PATTERNS tag to specify one or more wildcard pattern (like *.cpp # and *.h) to filter out the source-files in the directories. If left # blank all files are included. EXAMPLE_PATTERNS = # If the EXAMPLE_RECURSIVE tag is set to YES then subdirectories will be # searched for input files to be used with the \include or \dontinclude # commands irrespective of the value of the RECURSIVE tag. # Possible values are YES and NO. If left blank NO is used. EXAMPLE_RECURSIVE = NO # The IMAGE_PATH tag can be used to specify one or more files or # directories that contain image that are included in the documentation (see # the \image command). IMAGE_PATH = # The INPUT_FILTER tag can be used to specify a program that doxygen should # invoke to filter for each input file. Doxygen will invoke the filter program # by executing (via popen()) the command , where # is the value of the INPUT_FILTER tag, and is the name of an # input file. Doxygen will then use the output that the filter program writes # to standard output. If FILTER_PATTERNS is specified, this tag will be # ignored. INPUT_FILTER = # The FILTER_PATTERNS tag can be used to specify filters on a per file pattern # basis. Doxygen will compare the file name with each pattern and apply the # filter if there is a match. The filters are a list of the form: # pattern=filter (like *.cpp=my_cpp_filter). See INPUT_FILTER for further # info on how filters are used. If FILTER_PATTERNS is empty or if # non of the patterns match the file name, INPUT_FILTER is applied. FILTER_PATTERNS = # If the FILTER_SOURCE_FILES tag is set to YES, the input filter (if set using # INPUT_FILTER) will be used to filter the input files when producing source # files to browse (i.e. when SOURCE_BROWSER is set to YES). FILTER_SOURCE_FILES = NO # The FILTER_SOURCE_PATTERNS tag can be used to specify source filters per file # pattern. A pattern will override the setting for FILTER_PATTERN (if any) # and it is also possible to disable source filtering for a specific pattern # using *.ext= (so without naming a filter). This option only has effect when # FILTER_SOURCE_FILES is enabled. FILTER_SOURCE_PATTERNS = # If the USE_MD_FILE_AS_MAINPAGE tag refers to the name of a markdown file that # is part of the input, its contents will be placed on the main page (index.html). # This can be useful if you have a project on for instance GitHub and want reuse # the introduction page also for the doxygen output. USE_MDFILE_AS_MAINPAGE = #--------------------------------------------------------------------------- # configuration options related to source browsing #--------------------------------------------------------------------------- # If the SOURCE_BROWSER tag is set to YES then a list of source files will # be generated. Documented entities will be cross-referenced with these sources. # Note: To get rid of all source code in the generated output, make sure also # VERBATIM_HEADERS is set to NO. SOURCE_BROWSER = YES # Setting the INLINE_SOURCES tag to YES will include the body # of functions and classes directly in the documentation. INLINE_SOURCES = NO # Setting the STRIP_CODE_COMMENTS tag to YES (the default) will instruct # doxygen to hide any special comment blocks from generated source code # fragments. Normal C, C++ and Fortran comments will always remain visible. STRIP_CODE_COMMENTS = YES # If the REFERENCED_BY_RELATION tag is set to YES # then for each documented function all documented # functions referencing it will be listed. REFERENCED_BY_RELATION = YES # If the REFERENCES_RELATION tag is set to YES # then for each documented function all documented entities # called/used by that function will be listed. REFERENCES_RELATION = YES # If the REFERENCES_LINK_SOURCE tag is set to YES (the default) # and SOURCE_BROWSER tag is set to YES, then the hyperlinks from # functions in REFERENCES_RELATION and REFERENCED_BY_RELATION lists will # link to the source code. Otherwise they will link to the documentation. REFERENCES_LINK_SOURCE = YES # If the USE_HTAGS tag is set to YES then the references to source code # will point to the HTML generated by the htags(1) tool instead of doxygen # built-in source browser. The htags tool is part of GNU's global source # tagging system (see http://www.gnu.org/software/global/global.html). You # will need version 4.8.6 or higher. USE_HTAGS = NO # If the VERBATIM_HEADERS tag is set to YES (the default) then Doxygen # will generate a verbatim copy of the header file for each class for # which an include is specified. Set to NO to disable this. VERBATIM_HEADERS = YES #--------------------------------------------------------------------------- # configuration options related to the alphabetical class index #--------------------------------------------------------------------------- # If the ALPHABETICAL_INDEX tag is set to YES, an alphabetical index # of all compounds will be generated. Enable this if the project # contains a lot of classes, structs, unions or interfaces. ALPHABETICAL_INDEX = NO # If the alphabetical index is enabled (see ALPHABETICAL_INDEX) then # the COLS_IN_ALPHA_INDEX tag can be used to specify the number of columns # in which this list will be split (can be a number in the range [1..20]) COLS_IN_ALPHA_INDEX = 5 # In case all classes in a project start with a common prefix, all # classes will be put under the same header in the alphabetical index. # The IGNORE_PREFIX tag can be used to specify one or more prefixes that # should be ignored while generating the index headers. IGNORE_PREFIX = #--------------------------------------------------------------------------- # configuration options related to the HTML output #--------------------------------------------------------------------------- # If the GENERATE_HTML tag is set to YES (the default) Doxygen will # generate HTML output. GENERATE_HTML = YES # The HTML_OUTPUT tag is used to specify where the HTML docs will be put. # If a relative path is entered the value of OUTPUT_DIRECTORY will be # put in front of it. If left blank `html' will be used as the default path. HTML_OUTPUT = html # The HTML_FILE_EXTENSION tag can be used to specify the file extension for # each generated HTML page (for example: .htm,.php,.asp). If it is left blank # doxygen will generate files with .html extension. HTML_FILE_EXTENSION = .html # The HTML_HEADER tag can be used to specify a personal HTML header for # each generated HTML page. If it is left blank doxygen will generate a # standard header. Note that when using a custom header you are responsible # for the proper inclusion of any scripts and style sheets that doxygen # needs, which is dependent on the configuration options used. # It is advised to generate a default header using "doxygen -w html # header.html footer.html stylesheet.css YourConfigFile" and then modify # that header. Note that the header is subject to change so you typically # have to redo this when upgrading to a newer version of doxygen or when # changing the value of configuration settings such as GENERATE_TREEVIEW! HTML_HEADER = # The HTML_FOOTER tag can be used to specify a personal HTML footer for # each generated HTML page. If it is left blank doxygen will generate a # standard footer. HTML_FOOTER = # The HTML_STYLESHEET tag can be used to specify a user-defined cascading # style sheet that is used by each HTML page. It can be used to # fine-tune the look of the HTML output. If left blank doxygen will # generate a default style sheet. Note that it is recommended to use # HTML_EXTRA_STYLESHEET instead of this one, as it is more robust and this # tag will in the future become obsolete. HTML_STYLESHEET = # The HTML_EXTRA_STYLESHEET tag can be used to specify an additional # user-defined cascading style sheet that is included after the standard # style sheets created by doxygen. Using this option one can overrule # certain style aspects. This is preferred over using HTML_STYLESHEET # since it does not replace the standard style sheet and is therefor more # robust against future updates. Doxygen will copy the style sheet file to # the output directory. HTML_EXTRA_STYLESHEET = # The HTML_EXTRA_FILES tag can be used to specify one or more extra images or # other source files which should be copied to the HTML output directory. Note # that these files will be copied to the base HTML output directory. Use the # $relpath^ marker in the HTML_HEADER and/or HTML_FOOTER files to load these # files. In the HTML_STYLESHEET file, use the file name only. Also note that # the files will be copied as-is; there are no commands or markers available. HTML_EXTRA_FILES = # The HTML_COLORSTYLE_HUE tag controls the color of the HTML output. # Doxygen will adjust the colors in the style sheet and background images # according to this color. Hue is specified as an angle on a colorwheel, # see http://en.wikipedia.org/wiki/Hue for more information. # For instance the value 0 represents red, 60 is yellow, 120 is green, # 180 is cyan, 240 is blue, 300 purple, and 360 is red again. # The allowed range is 0 to 359. HTML_COLORSTYLE_HUE = 220 # The HTML_COLORSTYLE_SAT tag controls the purity (or saturation) of # the colors in the HTML output. For a value of 0 the output will use # grayscales only. A value of 255 will produce the most vivid colors. HTML_COLORSTYLE_SAT = 100 # The HTML_COLORSTYLE_GAMMA tag controls the gamma correction applied to # the luminance component of the colors in the HTML output. Values below # 100 gradually make the output lighter, whereas values above 100 make # the output darker. The value divided by 100 is the actual gamma applied, # so 80 represents a gamma of 0.8, The value 220 represents a gamma of 2.2, # and 100 does not change the gamma. HTML_COLORSTYLE_GAMMA = 80 # If the HTML_TIMESTAMP tag is set to YES then the footer of each generated HTML # page will contain the date and time when the page was generated. Setting # this to NO can help when comparing the output of multiple runs. HTML_TIMESTAMP = YES # If the HTML_DYNAMIC_SECTIONS tag is set to YES then the generated HTML # documentation will contain sections that can be hidden and shown after the # page has loaded. HTML_DYNAMIC_SECTIONS = YES # With HTML_INDEX_NUM_ENTRIES one can control the preferred number of # entries shown in the various tree structured indices initially; the user # can expand and collapse entries dynamically later on. Doxygen will expand # the tree to such a level that at most the specified number of entries are # visible (unless a fully collapsed tree already exceeds this amount). # So setting the number of entries 1 will produce a full collapsed tree by # default. 0 is a special value representing an infinite number of entries # and will result in a full expanded tree by default. HTML_INDEX_NUM_ENTRIES = 100 # If the GENERATE_DOCSET tag is set to YES, additional index files # will be generated that can be used as input for Apple's Xcode 3 # integrated development environment, introduced with OSX 10.5 (Leopard). # To create a documentation set, doxygen will generate a Makefile in the # HTML output directory. Running make will produce the docset in that # directory and running "make install" will install the docset in # ~/Library/Developer/Shared/Documentation/DocSets so that Xcode will find # it at startup. # See http://developer.apple.com/tools/creatingdocsetswithdoxygen.html # for more information. GENERATE_DOCSET = YES # When GENERATE_DOCSET tag is set to YES, this tag determines the name of the # feed. A documentation feed provides an umbrella under which multiple # documentation sets from a single provider (such as a company or product suite) # can be grouped. DOCSET_FEEDNAME = "Bio++ Sequence Library - Omics components" # When GENERATE_DOCSET tag is set to YES, this tag specifies a string that # should uniquely identify the documentation set bundle. This should be a # reverse domain-name style string, e.g. com.mycompany.MyDocSet. Doxygen # will append .docset to the name. DOCSET_BUNDLE_ID = bpp.seq.omics # When GENERATE_PUBLISHER_ID tag specifies a string that should uniquely # identify the documentation publisher. This should be a reverse domain-name # style string, e.g. com.mycompany.MyDocSet.documentation. DOCSET_PUBLISHER_ID = org.doxygen.Publisher # The GENERATE_PUBLISHER_NAME tag identifies the documentation publisher. DOCSET_PUBLISHER_NAME = Publisher # If the GENERATE_HTMLHELP tag is set to YES, additional index files # will be generated that can be used as input for tools like the # Microsoft HTML help workshop to generate a compiled HTML help file (.chm) # of the generated HTML documentation. GENERATE_HTMLHELP = NO # If the GENERATE_HTMLHELP tag is set to YES, the CHM_FILE tag can # be used to specify the file name of the resulting .chm file. You # can add a path in front of the file if the result should not be # written to the html output directory. CHM_FILE = # If the GENERATE_HTMLHELP tag is set to YES, the HHC_LOCATION tag can # be used to specify the location (absolute path including file name) of # the HTML help compiler (hhc.exe). If non-empty doxygen will try to run # the HTML help compiler on the generated index.hhp. HHC_LOCATION = # If the GENERATE_HTMLHELP tag is set to YES, the GENERATE_CHI flag # controls if a separate .chi index file is generated (YES) or that # it should be included in the master .chm file (NO). GENERATE_CHI = NO # If the GENERATE_HTMLHELP tag is set to YES, the CHM_INDEX_ENCODING # is used to encode HtmlHelp index (hhk), content (hhc) and project file # content. CHM_INDEX_ENCODING = # If the GENERATE_HTMLHELP tag is set to YES, the BINARY_TOC flag # controls whether a binary table of contents is generated (YES) or a # normal table of contents (NO) in the .chm file. BINARY_TOC = NO # The TOC_EXPAND flag can be set to YES to add extra items for group members # to the contents of the HTML help documentation and to the tree view. TOC_EXPAND = NO # If the GENERATE_QHP tag is set to YES and both QHP_NAMESPACE and # QHP_VIRTUAL_FOLDER are set, an additional index file will be generated # that can be used as input for Qt's qhelpgenerator to generate a # Qt Compressed Help (.qch) of the generated HTML documentation. GENERATE_QHP = NO # If the QHG_LOCATION tag is specified, the QCH_FILE tag can # be used to specify the file name of the resulting .qch file. # The path specified is relative to the HTML output folder. QCH_FILE = # The QHP_NAMESPACE tag specifies the namespace to use when generating # Qt Help Project output. For more information please see # http://doc.trolltech.com/qthelpproject.html#namespace QHP_NAMESPACE = org.doxygen.Project # The QHP_VIRTUAL_FOLDER tag specifies the namespace to use when generating # Qt Help Project output. For more information please see # http://doc.trolltech.com/qthelpproject.html#virtual-folders QHP_VIRTUAL_FOLDER = doc # If QHP_CUST_FILTER_NAME is set, it specifies the name of a custom filter to # add. For more information please see # http://doc.trolltech.com/qthelpproject.html#custom-filters QHP_CUST_FILTER_NAME = # The QHP_CUST_FILT_ATTRS tag specifies the list of the attributes of the # custom filter to add. For more information please see # # Qt Help Project / Custom Filters. QHP_CUST_FILTER_ATTRS = # The QHP_SECT_FILTER_ATTRS tag specifies the list of the attributes this # project's # filter section matches. # # Qt Help Project / Filter Attributes. QHP_SECT_FILTER_ATTRS = # If the GENERATE_QHP tag is set to YES, the QHG_LOCATION tag can # be used to specify the location of Qt's qhelpgenerator. # If non-empty doxygen will try to run qhelpgenerator on the generated # .qhp file. QHG_LOCATION = # If the GENERATE_ECLIPSEHELP tag is set to YES, additional index files # will be generated, which together with the HTML files, form an Eclipse help # plugin. To install this plugin and make it available under the help contents # menu in Eclipse, the contents of the directory containing the HTML and XML # files needs to be copied into the plugins directory of eclipse. The name of # the directory within the plugins directory should be the same as # the ECLIPSE_DOC_ID value. After copying Eclipse needs to be restarted before # the help appears. GENERATE_ECLIPSEHELP = NO # A unique identifier for the eclipse help plugin. When installing the plugin # the directory name containing the HTML and XML files should also have # this name. ECLIPSE_DOC_ID = org.doxygen.Project # The DISABLE_INDEX tag can be used to turn on/off the condensed index (tabs) # at top of each HTML page. The value NO (the default) enables the index and # the value YES disables it. Since the tabs have the same information as the # navigation tree you can set this option to NO if you already set # GENERATE_TREEVIEW to YES. DISABLE_INDEX = NO # The GENERATE_TREEVIEW tag is used to specify whether a tree-like index # structure should be generated to display hierarchical information. # If the tag value is set to YES, a side panel will be generated # containing a tree-like index structure (just like the one that # is generated for HTML Help). For this to work a browser that supports # JavaScript, DHTML, CSS and frames is required (i.e. any modern browser). # Windows users are probably better off using the HTML help feature. # Since the tree basically has the same information as the tab index you # could consider to set DISABLE_INDEX to NO when enabling this option. GENERATE_TREEVIEW = YES # The ENUM_VALUES_PER_LINE tag can be used to set the number of enum values # (range [0,1..20]) that doxygen will group on one line in the generated HTML # documentation. Note that a value of 0 will completely suppress the enum # values from appearing in the overview section. ENUM_VALUES_PER_LINE = 4 # If the treeview is enabled (see GENERATE_TREEVIEW) then this tag can be # used to set the initial width (in pixels) of the frame in which the tree # is shown. TREEVIEW_WIDTH = 250 # When the EXT_LINKS_IN_WINDOW option is set to YES doxygen will open # links to external symbols imported via tag files in a separate window. EXT_LINKS_IN_WINDOW = NO # Use this tag to change the font size of Latex formulas included # as images in the HTML documentation. The default is 10. Note that # when you change the font size after a successful doxygen run you need # to manually remove any form_*.png images from the HTML output directory # to force them to be regenerated. FORMULA_FONTSIZE = 10 # Use the FORMULA_TRANPARENT tag to determine whether or not the images # generated for formulas are transparent PNGs. Transparent PNGs are # not supported properly for IE 6.0, but are supported on all modern browsers. # Note that when changing this option you need to delete any form_*.png files # in the HTML output before the changes have effect. FORMULA_TRANSPARENT = YES # Enable the USE_MATHJAX option to render LaTeX formulas using MathJax # (see http://www.mathjax.org) which uses client side Javascript for the # rendering instead of using prerendered bitmaps. Use this if you do not # have LaTeX installed or if you want to formulas look prettier in the HTML # output. When enabled you may also need to install MathJax separately and # configure the path to it using the MATHJAX_RELPATH option. USE_MATHJAX = NO # When MathJax is enabled you can set the default output format to be used for # thA MathJax output. Supported types are HTML-CSS, NativeMML (i.e. MathML) and # SVG. The default value is HTML-CSS, which is slower, but has the best # compatibility. MATHJAX_FORMAT = HTML-CSS # When MathJax is enabled you need to specify the location relative to the # HTML output directory using the MATHJAX_RELPATH option. The destination # directory should contain the MathJax.js script. For instance, if the mathjax # directory is located at the same level as the HTML output directory, then # MATHJAX_RELPATH should be ../mathjax. The default value points to # the MathJax Content Delivery Network so you can quickly see the result without # installing MathJax. However, it is strongly recommended to install a local # copy of MathJax from http://www.mathjax.org before deployment. MATHJAX_RELPATH = http://cdn.mathjax.org/mathjax/latest # The MATHJAX_EXTENSIONS tag can be used to specify one or MathJax extension # names that should be enabled during MathJax rendering. MATHJAX_EXTENSIONS = # When the SEARCHENGINE tag is enabled doxygen will generate a search box # for the HTML output. The underlying search engine uses javascript # and DHTML and should work on any modern browser. Note that when using # HTML help (GENERATE_HTMLHELP), Qt help (GENERATE_QHP), or docsets # (GENERATE_DOCSET) there is already a search function so this one should # typically be disabled. For large projects the javascript based search engine # can be slow, then enabling SERVER_BASED_SEARCH may provide a better solution. SEARCHENGINE = YES # When the SERVER_BASED_SEARCH tag is enabled the search engine will be # implemented using a web server instead of a web client using Javascript. # There are two flavours of web server based search depending on the # EXTERNAL_SEARCH setting. When disabled, doxygen will generate a PHP script for # searching and an index file used by the script. When EXTERNAL_SEARCH is # enabled the indexing and searching needs to be provided by external tools. # See the manual for details. SERVER_BASED_SEARCH = NO # When EXTERNAL_SEARCH is enabled doxygen will no longer generate the PHP # script for searching. Instead the search results are written to an XML file # which needs to be processed by an external indexer. Doxygen will invoke an # external search engine pointed to by the SEARCHENGINE_URL option to obtain # the search results. Doxygen ships with an example indexer (doxyindexer) and # search engine (doxysearch.cgi) which are based on the open source search engine # library Xapian. See the manual for configuration details. EXTERNAL_SEARCH = NO # The SEARCHENGINE_URL should point to a search engine hosted by a web server # which will returned the search results when EXTERNAL_SEARCH is enabled. # Doxygen ships with an example search engine (doxysearch) which is based on # the open source search engine library Xapian. See the manual for configuration # details. SEARCHENGINE_URL = # When SERVER_BASED_SEARCH and EXTERNAL_SEARCH are both enabled the unindexed # search data is written to a file for indexing by an external tool. With the # SEARCHDATA_FILE tag the name of this file can be specified. SEARCHDATA_FILE = searchdata.xml # When SERVER_BASED_SEARCH AND EXTERNAL_SEARCH are both enabled the # EXTERNAL_SEARCH_ID tag can be used as an identifier for the project. This is # useful in combination with EXTRA_SEARCH_MAPPINGS to search through multiple # projects and redirect the results back to the right project. EXTERNAL_SEARCH_ID = # The EXTRA_SEARCH_MAPPINGS tag can be used to enable searching through doxygen # projects other than the one defined by this configuration file, but that are # all added to the same external search index. Each project needs to have a # unique id set via EXTERNAL_SEARCH_ID. The search mapping then maps the id # of to a relative location where the documentation can be found. # The format is: EXTRA_SEARCH_MAPPINGS = id1=loc1 id2=loc2 ... EXTRA_SEARCH_MAPPINGS = #--------------------------------------------------------------------------- # configuration options related to the LaTeX output #--------------------------------------------------------------------------- # If the GENERATE_LATEX tag is set to YES (the default) Doxygen will # generate Latex output. GENERATE_LATEX = NO # The LATEX_OUTPUT tag is used to specify where the LaTeX docs will be put. # If a relative path is entered the value of OUTPUT_DIRECTORY will be # put in front of it. If left blank `latex' will be used as the default path. LATEX_OUTPUT = latex # The LATEX_CMD_NAME tag can be used to specify the LaTeX command name to be # invoked. If left blank `latex' will be used as the default command name. # Note that when enabling USE_PDFLATEX this option is only used for # generating bitmaps for formulas in the HTML output, but not in the # Makefile that is written to the output directory. LATEX_CMD_NAME = latex # The MAKEINDEX_CMD_NAME tag can be used to specify the command name to # generate index for LaTeX. If left blank `makeindex' will be used as the # default command name. MAKEINDEX_CMD_NAME = makeindex # If the COMPACT_LATEX tag is set to YES Doxygen generates more compact # LaTeX documents. This may be useful for small projects and may help to # save some trees in general. COMPACT_LATEX = NO # The PAPER_TYPE tag can be used to set the paper type that is used # by the printer. Possible values are: a4, letter, legal and # executive. If left blank a4wide will be used. PAPER_TYPE = a4wide # The EXTRA_PACKAGES tag can be to specify one or more names of LaTeX # packages that should be included in the LaTeX output. EXTRA_PACKAGES = amsmath # The LATEX_HEADER tag can be used to specify a personal LaTeX header for # the generated latex document. The header should contain everything until # the first chapter. If it is left blank doxygen will generate a # standard header. Notice: only use this tag if you know what you are doing! LATEX_HEADER = # The LATEX_FOOTER tag can be used to specify a personal LaTeX footer for # the generated latex document. The footer should contain everything after # the last chapter. If it is left blank doxygen will generate a # standard footer. Notice: only use this tag if you know what you are doing! LATEX_FOOTER = # The LATEX_EXTRA_FILES tag can be used to specify one or more extra images # or other source files which should be copied to the LaTeX output directory. # Note that the files will be copied as-is; there are no commands or markers # available. LATEX_EXTRA_FILES = # If the PDF_HYPERLINKS tag is set to YES, the LaTeX that is generated # is prepared for conversion to pdf (using ps2pdf). The pdf file will # contain links (just like the HTML output) instead of page references # This makes the output suitable for online browsing using a pdf viewer. PDF_HYPERLINKS = NO # If the USE_PDFLATEX tag is set to YES, pdflatex will be used instead of # plain latex in the generated Makefile. Set this option to YES to get a # higher quality PDF documentation. USE_PDFLATEX = YES # If the LATEX_BATCHMODE tag is set to YES, doxygen will add the \\batchmode. # command to the generated LaTeX files. This will instruct LaTeX to keep # running if errors occur, instead of asking the user for help. # This option is also used when generating formulas in HTML. LATEX_BATCHMODE = NO # If LATEX_HIDE_INDICES is set to YES then doxygen will not # include the index chapters (such as File Index, Compound Index, etc.) # in the output. LATEX_HIDE_INDICES = NO # If LATEX_SOURCE_CODE is set to YES then doxygen will include # source code with syntax highlighting in the LaTeX output. # Note that which sources are shown also depends on other settings # such as SOURCE_BROWSER. LATEX_SOURCE_CODE = NO # The LATEX_BIB_STYLE tag can be used to specify the style to use for the # bibliography, e.g. plainnat, or ieeetr. The default style is "plain". See # http://en.wikipedia.org/wiki/BibTeX for more info. LATEX_BIB_STYLE = plain #--------------------------------------------------------------------------- # configuration options related to the RTF output #--------------------------------------------------------------------------- # If the GENERATE_RTF tag is set to YES Doxygen will generate RTF output # The RTF output is optimized for Word 97 and may not look very pretty with # other RTF readers or editors. GENERATE_RTF = NO # The RTF_OUTPUT tag is used to specify where the RTF docs will be put. # If a relative path is entered the value of OUTPUT_DIRECTORY will be # put in front of it. If left blank `rtf' will be used as the default path. RTF_OUTPUT = rtf # If the COMPACT_RTF tag is set to YES Doxygen generates more compact # RTF documents. This may be useful for small projects and may help to # save some trees in general. COMPACT_RTF = NO # If the RTF_HYPERLINKS tag is set to YES, the RTF that is generated # will contain hyperlink fields. The RTF file will # contain links (just like the HTML output) instead of page references. # This makes the output suitable for online browsing using WORD or other # programs which support those fields. # Note: wordpad (write) and others do not support links. RTF_HYPERLINKS = NO # Load style sheet definitions from file. Syntax is similar to doxygen's # config file, i.e. a series of assignments. You only have to provide # replacements, missing definitions are set to their default value. RTF_STYLESHEET_FILE = # Set optional variables used in the generation of an rtf document. # Syntax is similar to doxygen's config file. RTF_EXTENSIONS_FILE = #--------------------------------------------------------------------------- # configuration options related to the man page output #--------------------------------------------------------------------------- # If the GENERATE_MAN tag is set to YES (the default) Doxygen will # generate man pages GENERATE_MAN = NO # The MAN_OUTPUT tag is used to specify where the man pages will be put. # If a relative path is entered the value of OUTPUT_DIRECTORY will be # put in front of it. If left blank `man' will be used as the default path. MAN_OUTPUT = man # The MAN_EXTENSION tag determines the extension that is added to # the generated man pages (default is the subroutine's section .3) MAN_EXTENSION = .3 # If the MAN_LINKS tag is set to YES and Doxygen generates man output, # then it will generate one additional man file for each entity # documented in the real man page(s). These additional files # only source the real man page, but without them the man command # would be unable to find the correct page. The default is NO. MAN_LINKS = NO #--------------------------------------------------------------------------- # configuration options related to the XML output #--------------------------------------------------------------------------- # If the GENERATE_XML tag is set to YES Doxygen will # generate an XML file that captures the structure of # the code including all documentation. GENERATE_XML = NO # The XML_OUTPUT tag is used to specify where the XML pages will be put. # If a relative path is entered the value of OUTPUT_DIRECTORY will be # put in front of it. If left blank `xml' will be used as the default path. XML_OUTPUT = xml # The XML_SCHEMA tag can be used to specify an XML schema, # which can be used by a validating XML parser to check the # syntax of the XML files. XML_SCHEMA = # The XML_DTD tag can be used to specify an XML DTD, # which can be used by a validating XML parser to check the # syntax of the XML files. XML_DTD = # If the XML_PROGRAMLISTING tag is set to YES Doxygen will # dump the program listings (including syntax highlighting # and cross-referencing information) to the XML output. Note that # enabling this will significantly increase the size of the XML output. XML_PROGRAMLISTING = YES #--------------------------------------------------------------------------- # configuration options related to the DOCBOOK output #--------------------------------------------------------------------------- # If the GENERATE_DOCBOOK tag is set to YES Doxygen will generate DOCBOOK files # that can be used to generate PDF. GENERATE_DOCBOOK = NO # The DOCBOOK_OUTPUT tag is used to specify where the DOCBOOK pages will be put. # If a relative path is entered the value of OUTPUT_DIRECTORY will be put in # front of it. If left blank docbook will be used as the default path. DOCBOOK_OUTPUT = docbook #--------------------------------------------------------------------------- # configuration options for the AutoGen Definitions output #--------------------------------------------------------------------------- # If the GENERATE_AUTOGEN_DEF tag is set to YES Doxygen will # generate an AutoGen Definitions (see autogen.sf.net) file # that captures the structure of the code including all # documentation. Note that this feature is still experimental # and incomplete at the moment. GENERATE_AUTOGEN_DEF = NO #--------------------------------------------------------------------------- # configuration options related to the Perl module output #--------------------------------------------------------------------------- # If the GENERATE_PERLMOD tag is set to YES Doxygen will # generate a Perl module file that captures the structure of # the code including all documentation. Note that this # feature is still experimental and incomplete at the # moment. GENERATE_PERLMOD = NO # If the PERLMOD_LATEX tag is set to YES Doxygen will generate # the necessary Makefile rules, Perl scripts and LaTeX code to be able # to generate PDF and DVI output from the Perl module output. PERLMOD_LATEX = NO # If the PERLMOD_PRETTY tag is set to YES the Perl module output will be # nicely formatted so it can be parsed by a human reader. This is useful # if you want to understand what is going on. On the other hand, if this # tag is set to NO the size of the Perl module output will be much smaller # and Perl will parse it just the same. PERLMOD_PRETTY = YES # The names of the make variables in the generated doxyrules.make file # are prefixed with the string contained in PERLMOD_MAKEVAR_PREFIX. # This is useful so different doxyrules.make files included by the same # Makefile don't overwrite each other's variables. PERLMOD_MAKEVAR_PREFIX = #--------------------------------------------------------------------------- # Configuration options related to the preprocessor #--------------------------------------------------------------------------- # If the ENABLE_PREPROCESSING tag is set to YES (the default) Doxygen will # evaluate all C-preprocessor directives found in the sources and include # files. ENABLE_PREPROCESSING = YES # If the MACRO_EXPANSION tag is set to YES Doxygen will expand all macro # names in the source code. If set to NO (the default) only conditional # compilation will be performed. Macro expansion can be done in a controlled # way by setting EXPAND_ONLY_PREDEF to YES. MACRO_EXPANSION = NO # If the EXPAND_ONLY_PREDEF and MACRO_EXPANSION tags are both set to YES # then the macro expansion is limited to the macros specified with the # PREDEFINED and EXPAND_AS_DEFINED tags. EXPAND_ONLY_PREDEF = NO # If the SEARCH_INCLUDES tag is set to YES (the default) the includes files # pointed to by INCLUDE_PATH will be searched when a #include is found. SEARCH_INCLUDES = YES # The INCLUDE_PATH tag can be used to specify one or more directories that # contain include files that are not input files but should be processed by # the preprocessor. INCLUDE_PATH = # You can use the INCLUDE_FILE_PATTERNS tag to specify one or more wildcard # patterns (like *.h and *.hpp) to filter out the header-files in the # directories. If left blank, the patterns specified with FILE_PATTERNS will # be used. INCLUDE_FILE_PATTERNS = # The PREDEFINED tag can be used to specify one or more macro names that # are defined before the preprocessor is started (similar to the -D option of # gcc). The argument of the tag is a list of macros of the form: name # or name=definition (no spaces). If the definition and the = are # omitted =1 is assumed. To prevent a macro definition from being # undefined via #undef or recursively expanded use the := operator # instead of the = operator. PREDEFINED = # If the MACRO_EXPANSION and EXPAND_ONLY_PREDEF tags are set to YES then # this tag can be used to specify a list of macro names that should be expanded. # The macro definition that is found in the sources will be used. # Use the PREDEFINED tag if you want to use a different macro definition that # overrules the definition found in the source code. EXPAND_AS_DEFINED = # If the SKIP_FUNCTION_MACROS tag is set to YES (the default) then # doxygen's preprocessor will remove all references to function-like macros # that are alone on a line, have an all uppercase name, and do not end with a # semicolon, because these will confuse the parser if not removed. SKIP_FUNCTION_MACROS = YES #--------------------------------------------------------------------------- # Configuration::additions related to external references #--------------------------------------------------------------------------- # The TAGFILES option can be used to specify one or more tagfiles. For each # tag file the location of the external documentation should be added. The # format of a tag file without this location is as follows: # TAGFILES = file1 file2 ... # Adding location for the tag files is done as follows: # TAGFILES = file1=loc1 "file2 = loc2" ... # where "loc1" and "loc2" can be relative or absolute paths # or URLs. Note that each tag file must have a unique name (where the name does # NOT include the path). If a tag file is not located in the directory in which # doxygen is run, you must also specify the path to the tagfile here. TAGFILES = ../bpp-core/BppCore.tag=../../bpp-core/html/ \ ../bpp-seq/BppSeq.tag=../../bpp-seq/html # When a file name is specified after GENERATE_TAGFILE, doxygen will create # a tag file that is based on the input files it reads. GENERATE_TAGFILE = BppSeqOmics.tag # If the ALLEXTERNALS tag is set to YES all external classes will be listed # in the class index. If set to NO only the inherited external classes # will be listed. ALLEXTERNALS = NO # If the EXTERNAL_GROUPS tag is set to YES all external groups will be listed # in the modules index. If set to NO, only the current project's groups will # be listed. EXTERNAL_GROUPS = YES # If the EXTERNAL_PAGES tag is set to YES all external pages will be listed # in the related pages index. If set to NO, only the current project's # pages will be listed. EXTERNAL_PAGES = YES # The PERL_PATH should be the absolute path and name of the perl script # interpreter (i.e. the result of `which perl'). PERL_PATH = /usr/bin/perl #--------------------------------------------------------------------------- # Configuration options related to the dot tool #--------------------------------------------------------------------------- # If the CLASS_DIAGRAMS tag is set to YES (the default) Doxygen will # generate a inheritance diagram (in HTML, RTF and LaTeX) for classes with base # or super classes. Setting the tag to NO turns the diagrams off. Note that # this option also works with HAVE_DOT disabled, but it is recommended to # install and use dot, since it yields more powerful graphs. CLASS_DIAGRAMS = YES # You can define message sequence charts within doxygen comments using the \msc # command. Doxygen will then run the mscgen tool (see # http://www.mcternan.me.uk/mscgen/) to produce the chart and insert it in the # documentation. The MSCGEN_PATH tag allows you to specify the directory where # the mscgen tool resides. If left empty the tool is assumed to be found in the # default search path. MSCGEN_PATH = # If set to YES, the inheritance and collaboration graphs will hide # inheritance and usage relations if the target is undocumented # or is not a class. HIDE_UNDOC_RELATIONS = YES # If you set the HAVE_DOT tag to YES then doxygen will assume the dot tool is # available from the path. This tool is part of Graphviz, a graph visualization # toolkit from AT&T and Lucent Bell Labs. The other options in this section # have no effect if this option is set to NO (the default) HAVE_DOT = YES # The DOT_NUM_THREADS specifies the number of dot invocations doxygen is # allowed to run in parallel. When set to 0 (the default) doxygen will # base this on the number of processors available in the system. You can set it # explicitly to a value larger than 0 to get control over the balance # between CPU load and processing speed. DOT_NUM_THREADS = 0 # By default doxygen will use the Helvetica font for all dot files that # doxygen generates. When you want a differently looking font you can specify # the font name using DOT_FONTNAME. You need to make sure dot is able to find # the font, which can be done by putting it in a standard location or by setting # the DOTFONTPATH environment variable or by setting DOT_FONTPATH to the # directory containing the font. DOT_FONTNAME = FreeSans # The DOT_FONTSIZE tag can be used to set the size of the font of dot graphs. # The default size is 10pt. DOT_FONTSIZE = 10 # By default doxygen will tell dot to use the Helvetica font. # If you specify a different font using DOT_FONTNAME you can use DOT_FONTPATH to # set the path where dot can find it. DOT_FONTPATH = # If the CLASS_GRAPH and HAVE_DOT tags are set to YES then doxygen # will generate a graph for each documented class showing the direct and # indirect inheritance relations. Setting this tag to YES will force the # CLASS_DIAGRAMS tag to NO. CLASS_GRAPH = YES # If the COLLABORATION_GRAPH and HAVE_DOT tags are set to YES then doxygen # will generate a graph for each documented class showing the direct and # indirect implementation dependencies (inheritance, containment, and # class references variables) of the class with other documented classes. COLLABORATION_GRAPH = YES # If the GROUP_GRAPHS and HAVE_DOT tags are set to YES then doxygen # will generate a graph for groups, showing the direct groups dependencies GROUP_GRAPHS = YES # If the UML_LOOK tag is set to YES doxygen will generate inheritance and # collaboration diagrams in a style similar to the OMG's Unified Modeling # Language. UML_LOOK = NO # If the UML_LOOK tag is enabled, the fields and methods are shown inside # the class node. If there are many fields or methods and many nodes the # graph may become too big to be useful. The UML_LIMIT_NUM_FIELDS # threshold limits the number of items for each type to make the size more # managable. Set this to 0 for no limit. Note that the threshold may be # exceeded by 50% before the limit is enforced. UML_LIMIT_NUM_FIELDS = 10 # If set to YES, the inheritance and collaboration graphs will show the # relations between templates and their instances. TEMPLATE_RELATIONS = YES # If the ENABLE_PREPROCESSING, SEARCH_INCLUDES, INCLUDE_GRAPH, and HAVE_DOT # tags are set to YES then doxygen will generate a graph for each documented # file showing the direct and indirect include dependencies of the file with # other documented files. INCLUDE_GRAPH = YES # If the ENABLE_PREPROCESSING, SEARCH_INCLUDES, INCLUDED_BY_GRAPH, and # HAVE_DOT tags are set to YES then doxygen will generate a graph for each # documented header file showing the documented files that directly or # indirectly include this file. INCLUDED_BY_GRAPH = YES # If the CALL_GRAPH and HAVE_DOT options are set to YES then # doxygen will generate a call dependency graph for every global function # or class method. Note that enabling this option will significantly increase # the time of a run. So in most cases it will be better to enable call graphs # for selected functions only using the \callgraph command. CALL_GRAPH = NO # If the CALLER_GRAPH and HAVE_DOT tags are set to YES then # doxygen will generate a caller dependency graph for every global function # or class method. Note that enabling this option will significantly increase # the time of a run. So in most cases it will be better to enable caller # graphs for selected functions only using the \callergraph command. CALLER_GRAPH = NO # If the GRAPHICAL_HIERARCHY and HAVE_DOT tags are set to YES then doxygen # will generate a graphical hierarchy of all classes instead of a textual one. GRAPHICAL_HIERARCHY = YES # If the DIRECTORY_GRAPH and HAVE_DOT tags are set to YES # then doxygen will show the dependencies a directory has on other directories # in a graphical way. The dependency relations are determined by the #include # relations between the files in the directories. DIRECTORY_GRAPH = YES # The DOT_IMAGE_FORMAT tag can be used to set the image format of the images # generated by dot. Possible values are svg, png, jpg, or gif. # If left blank png will be used. If you choose svg you need to set # HTML_FILE_EXTENSION to xhtml in order to make the SVG files # visible in IE 9+ (other browsers do not have this requirement). DOT_IMAGE_FORMAT = png # If DOT_IMAGE_FORMAT is set to svg, then this option can be set to YES to # enable generation of interactive SVG images that allow zooming and panning. # Note that this requires a modern browser other than Internet Explorer. # Tested and working are Firefox, Chrome, Safari, and Opera. For IE 9+ you # need to set HTML_FILE_EXTENSION to xhtml in order to make the SVG files # visible. Older versions of IE do not have SVG support. INTERACTIVE_SVG = NO # The tag DOT_PATH can be used to specify the path where the dot tool can be # found. If left blank, it is assumed the dot tool can be found in the path. DOT_PATH = # The DOTFILE_DIRS tag can be used to specify one or more directories that # contain dot files that are included in the documentation (see the # \dotfile command). DOTFILE_DIRS = # The MSCFILE_DIRS tag can be used to specify one or more directories that # contain msc files that are included in the documentation (see the # \mscfile command). MSCFILE_DIRS = # The DOT_GRAPH_MAX_NODES tag can be used to set the maximum number of # nodes that will be shown in the graph. If the number of nodes in a graph # becomes larger than this value, doxygen will truncate the graph, which is # visualized by representing a node as a red box. Note that doxygen if the # number of direct children of the root node in a graph is already larger than # DOT_GRAPH_MAX_NODES then the graph will not be shown at all. Also note # that the size of a graph can be further restricted by MAX_DOT_GRAPH_DEPTH. DOT_GRAPH_MAX_NODES = 50 # The MAX_DOT_GRAPH_DEPTH tag can be used to set the maximum depth of the # graphs generated by dot. A depth value of 3 means that only nodes reachable # from the root by following a path via at most 3 edges will be shown. Nodes # that lay further from the root node will be omitted. Note that setting this # option to 1 or 2 may greatly reduce the computation time needed for large # code bases. Also note that the size of a graph can be further restricted by # DOT_GRAPH_MAX_NODES. Using a depth of 0 means no depth restriction. MAX_DOT_GRAPH_DEPTH = 0 # Set the DOT_TRANSPARENT tag to YES to generate images with a transparent # background. This is disabled by default, because dot on Windows does not # seem to support this out of the box. Warning: Depending on the platform used, # enabling this option may lead to badly anti-aliased labels on the edges of # a graph (i.e. they become hard to read). DOT_TRANSPARENT = NO # Set the DOT_MULTI_TARGETS tag to YES allow dot to generate multiple output # files in one run (i.e. multiple -o and -T options on the command line). This # makes dot run faster, but since only newer versions of dot (>1.8.10) # support this, this feature is disabled by default. DOT_MULTI_TARGETS = YES # If the GENERATE_LEGEND tag is set to YES (the default) Doxygen will # generate a legend page explaining the meaning of the various boxes and # arrows in the dot generated graphs. GENERATE_LEGEND = YES # If the DOT_CLEANUP tag is set to YES (the default) Doxygen will # remove the intermediate dot files that are used to generate # the various graphs. DOT_CLEANUP = YES bpp-seq-omics-2.2.0/BppSeqOmics.tag000664 001750 001750 00000646676 12407766157 020610 0ustar00jdutheiljdutheil000000 000000 FeatureReader.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/ FeatureReader_8h SequenceFeature.h bpp::FeatureReader GffFeatureReader.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/Gff/ GffFeatureReader_8cpp GffFeatureReader.h GffFeatureReader.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/Gff/ GffFeatureReader_8h ../SequenceFeature.h ../FeatureReader.h bpp::GffFeatureReader GtfFeatureReader.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/Gtf/ GtfFeatureReader_8cpp GtfFeatureReader.h GtfFeatureReader.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/Gtf/ GtfFeatureReader_8h ../SequenceFeature.h ../FeatureReader.h bpp::GtfFeatureReader SequenceFeature.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/ SequenceFeature_8cpp SequenceFeature.h SequenceFeature.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/ SequenceFeature_8h bpp::SeqRange bpp::SequenceFeature bpp::BasicSequenceFeature bpp::SequenceFeatureSet SequenceFeatureTools.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/ SequenceFeatureTools_8cpp SequenceFeatureTools.h SequenceFeatureTools.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/ SequenceFeatureTools_8h SequenceFeature.h bpp::SequenceFeatureTools Fastq.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/ Fastq_8cpp Fastq.h Fastq.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/ Fastq_8h bpp::Fastq AlignmentFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ AlignmentFilterMafIterator_8cpp AlignmentFilterMafIterator.h AlignmentFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ AlignmentFilterMafIterator_8h MafIterator.h bpp::AlignmentFilterMafIterator bpp::AlignmentFilter2MafIterator BlockLengthMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ BlockLengthMafIterator_8h MafIterator.h bpp::BlockLengthMafIterator BlockMergerMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ BlockMergerMafIterator_8cpp BlockMergerMafIterator.h BlockMergerMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ BlockMergerMafIterator_8h MafIterator.h bpp::BlockMergerMafIterator BlockSizeMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ BlockSizeMafIterator_8h MafIterator.h bpp::BlockSizeMafIterator ChromosomeMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ ChromosomeMafIterator_8cpp ChromosomeMafIterator.h ChromosomeMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ ChromosomeMafIterator_8h MafIterator.h bpp::ChromosomeMafIterator ConcatenateMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ ConcatenateMafIterator_8cpp ConcatenateMafIterator.h ConcatenateMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ ConcatenateMafIterator_8h MafIterator.h bpp::ConcatenateMafIterator CoordinatesOutputMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ CoordinatesOutputMafIterator_8cpp CoordinatesOutputMafIterator.h CoordinatesOutputMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ CoordinatesOutputMafIterator_8h MafIterator.h bpp::CoordinatesOutputMafIterator DuplicateFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ DuplicateFilterMafIterator_8cpp DuplicateFilterMafIterator.h DuplicateFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ DuplicateFilterMafIterator_8h MafIterator.h bpp::DuplicateFilterMafIterator EntropyFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ EntropyFilterMafIterator_8cpp EntropyFilterMafIterator.h EntropyFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ EntropyFilterMafIterator_8h MafIterator.h bpp::EntropyFilterMafIterator FeatureExtractorMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ FeatureExtractorMafIterator_8cpp FeatureExtractorMafIterator.h FeatureExtractorMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ FeatureExtractorMafIterator_8h MafIterator.h bpp::FeatureExtractor FeatureFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ FeatureFilterMafIterator_8cpp FeatureFilterMafIterator.h FeatureFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ FeatureFilterMafIterator_8h MafIterator.h bpp::FeatureFilterMafIterator FullGapFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ FullGapFilterMafIterator_8cpp FullGapFilterMafIterator.h FullGapFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ FullGapFilterMafIterator_8h MafIterator.h bpp::FullGapFilterMafIterator IterationListener.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ IterationListener_8cpp IterationListener.h IterationListener.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ IterationListener_8h MafIterator.h SequenceStatisticsMafIterator.h bpp::IterationListener bpp::AbstractStatisticsOutputIterationListener bpp::CsvStatisticsOutputIterationListener MafBlock.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafBlock_8h MafSequence.h bpp::MafBlock MafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafIterator_8cpp MafIterator.h IterationListener.h MafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafIterator_8h MafBlock.h bpp::MafIterator bpp::AbstractMafIterator bpp::MafTrashIterator bpp::AbstractFilterMafIterator bpp::TrashIteratorAdapter bpp::MafIteratorSynchronizer MafParser.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafParser_8cpp MafParser.h MafParser.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafParser_8h MafIterator.h bpp::MafParser MafSequence.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafSequence_8cpp MafSequence.h MafSequence.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafSequence_8h ../../Feature/SequenceFeature.h bpp::MafSequence MafStatistics.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafStatistics_8cpp MafStatistics.h MafStatistics.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MafStatistics_8h MafBlock.h bpp::MafStatisticsResult bpp::SimpleMafStatisticsResult bpp::MafStatistics bpp::AbstractMafStatistics bpp::AbstractMafStatisticsSimple bpp::PairwiseDivergenceMafStatistics bpp::BlockSizeMafStatistics bpp::BlockLengthMafStatistics bpp::SequenceLengthMafStatistics bpp::AlignmentScoreMafStatistics bpp::CharacterCountsMafStatistics bpp::AbstractSpeciesSelectionMafStatistics bpp::AbstractSpeciesMultipleSelectionMafStatistics bpp::SiteFrequencySpectrumMafStatistics bpp::SiteFrequencySpectrumMafStatistics::Categorizer bpp::FourSpeciesPatternCountsMafStatistics bpp::SiteMafStatistics bpp::PolymorphismMafStatistics bpp::SequenceDiversityMafStatistics MaskFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MaskFilterMafIterator_8cpp MaskFilterMafIterator.h MaskFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ MaskFilterMafIterator_8h MafIterator.h bpp::MaskFilterMafIterator OrphanSequenceFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ OrphanSequenceFilterMafIterator_8cpp OrphanSequenceFilterMafIterator.h OrphanSequenceFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ OrphanSequenceFilterMafIterator_8h MafIterator.h bpp::OrphanSequenceFilterMafIterator OutputAlignmentMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ OutputAlignmentMafIterator_8cpp OutputAlignmentMafIterator.h OutputAlignmentMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ OutputAlignmentMafIterator_8h MafIterator.h bpp::OutputAlignmentMafIterator OutputMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ OutputMafIterator_8cpp OutputMafIterator.h OutputMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ OutputMafIterator_8h MafIterator.h bpp::OutputMafIterator QualityFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ QualityFilterMafIterator_8cpp QualityFilterMafIterator.h QualityFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ QualityFilterMafIterator_8h MafIterator.h bpp::QualityFilterMafIterator SequenceFilterMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ SequenceFilterMafIterator_8cpp SequenceFilterMafIterator.h SequenceFilterMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ SequenceFilterMafIterator_8h MafIterator.h bpp::SequenceFilterMafIterator SequenceStatisticsMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ SequenceStatisticsMafIterator_8cpp SequenceStatisticsMafIterator.h SequenceStatisticsMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ SequenceStatisticsMafIterator_8h MafIterator.h MafStatistics.h bpp::SequenceStatisticsMafIterator SequenceStreamToMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ SequenceStreamToMafIterator_8cpp SequenceStreamToMafIterator.h SequenceStreamToMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ SequenceStreamToMafIterator_8h MafIterator.h bpp::SequenceStreamToMafIterator VcfOutputMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ VcfOutputMafIterator_8cpp VcfOutputMafIterator.h VcfOutputMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ VcfOutputMafIterator_8h MafIterator.h bpp::VcfOutputMafIterator WindowSplitMafIterator.cpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ WindowSplitMafIterator_8cpp WindowSplitMafIterator.h WindowSplitMafIterator.h /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ WindowSplitMafIterator_8h MafIterator.h bpp::WindowSplitMafIterator bpp::FeatureReader classbpp_1_1FeatureReader.html FeatureReader classbpp_1_1FeatureReader.html a68128d63b0ea2721edb3e962f8b7f100 () virtual ~FeatureReader classbpp_1_1FeatureReader.html ac73295336f384242fb4617c54924f143 () virtual bool hasMoreFeature classbpp_1_1FeatureReader.html aa29824199d9bdaa7e4334292f331dc24 () const =0 virtual const BasicSequenceFeature nextFeature classbpp_1_1FeatureReader.html a731a3c4d39218c404d8efc5b41bfdf74 ()=0 virtual void getAllFeatures classbpp_1_1FeatureReader.html a09b6c45821906b40564acefcf181090f (SequenceFeatureSet &features)=0 virtual void getFeaturesOfType classbpp_1_1FeatureReader.html a7964fe688089684b5e95dc2afabfee8d (const std::string &type, SequenceFeatureSet &features)=0 virtual void getFeaturesOfSequence classbpp_1_1FeatureReader.html a06849cd8436f2b9922307e44f65267cf (const std::string &seqId, SequenceFeatureSet &features)=0 bpp::GffFeatureReader classbpp_1_1GffFeatureReader.html bpp::FeatureReader GffFeatureReader classbpp_1_1GffFeatureReader.html af3c60965fe99ff574c8d9a079bccc03a (std::istream &input) bool hasMoreFeature classbpp_1_1GffFeatureReader.html acabf04ed7517fe4a8ab7087f955e1dde () const const BasicSequenceFeature nextFeature classbpp_1_1GffFeatureReader.html ae8157e4b32d5260140a7a5bae140a594 () void getAllFeatures classbpp_1_1GffFeatureReader.html ac084823ee501edeafcb9733b1d2a648f (SequenceFeatureSet &features) void getFeaturesOfType classbpp_1_1GffFeatureReader.html a6e9a99de920461f218a0edbb13bd070c (const std::string &type, SequenceFeatureSet &features) void getFeaturesOfSequence classbpp_1_1GffFeatureReader.html a3a344448dc2c55b96d6942e07f38d049 (const std::string &seqId, SequenceFeatureSet &features) static std::string toString classbpp_1_1GffFeatureReader.html a3ebd3115868d32f3fd6096817705962a (const bpp::SequenceFeature &f) static void toString classbpp_1_1GffFeatureReader.html afe361bf0f69ebb3c5c670d8e63258da7 (const bpp::SequenceFeature &f, std::ostream &out) static void toString classbpp_1_1GffFeatureReader.html ac9c84c4d8b8bbf811026063227cb752d (const bpp::SequenceFeatureSet &fs, std::ostream &out) static const std::string GFF_STRAND classbpp_1_1GffFeatureReader.html a12aa56a4dd1e927db0f28604d1360b30 static const std::string GFF_PHASE classbpp_1_1GffFeatureReader.html a74ae2f87a56a93eb297146e9e3824f35 static const std::string GFF_NAME classbpp_1_1GffFeatureReader.html ae5d3c41328d5a496091d998c0abaff6e static const std::string GFF_ALIAS classbpp_1_1GffFeatureReader.html a338fc168ca2d53810514d22be3bf27e1 static const std::string GFF_PARENT classbpp_1_1GffFeatureReader.html adef875e20ad7a8c8a492f2b14f5344f3 static const std::string GFF_TARGET classbpp_1_1GffFeatureReader.html a80e87dd3af08bd2738286dca3d91a8c9 static const std::string GFF_GAP classbpp_1_1GffFeatureReader.html ab4c5aad466aea96b7502b83675416ede static const std::string GFF_DERIVES_FROM classbpp_1_1GffFeatureReader.html a7b3777d1160b37872a1159812084c5b1 static const std::string GFF_NOTE classbpp_1_1GffFeatureReader.html a634d944b330e3613db1268a7af40ab7f static const std::string GFF_DBXREF classbpp_1_1GffFeatureReader.html a067da753e90c574a337b1ad68a5ef85e static const std::string GFF_ONTOLOGY_TERM classbpp_1_1GffFeatureReader.html a8c91c0b5fae46e560bed178c3f55111f static const std::string GFF_IS_CIRCULAR classbpp_1_1GffFeatureReader.html aa1d1484c9fa218bebc1e8e135b6c2167 GffFeatureReader classbpp_1_1GffFeatureReader.html ab994b6fe0a47c3f06b1f92fd43b1d2c7 (const GffFeatureReader &reader) GffFeatureReader & operator= classbpp_1_1GffFeatureReader.html a12a3435d52209113551ef075d27a4f33 (const GffFeatureReader &reader) void getNextLine_ classbpp_1_1GffFeatureReader.html a1a9ba4ac54dd236e8ad744eb4b8bc082 () std::istream * input_ classbpp_1_1GffFeatureReader.html a8daae5c7833c107f77e719f0909a55e1 std::string nextLine_ classbpp_1_1GffFeatureReader.html a507c0f43b2cd59d163100a5f85ff05f0 bpp::GtfFeatureReader classbpp_1_1GtfFeatureReader.html bpp::FeatureReader GtfFeatureReader classbpp_1_1GtfFeatureReader.html afc6b6d67b2b3f71dc008b6ff52472109 (std::istream &input) bool hasMoreFeature classbpp_1_1GtfFeatureReader.html a71e542bbef4679bab3e7f5956380f49a () const const BasicSequenceFeature nextFeature classbpp_1_1GtfFeatureReader.html ac47ae9b87521f012c6da6f3183c5aa51 () void getAllFeatures classbpp_1_1GtfFeatureReader.html a8c1cf5f048c3044eafccfe456c30fceb (SequenceFeatureSet &features) void getFeaturesOfType classbpp_1_1GtfFeatureReader.html af158dd45bcaf7f015db726d88b6508df (const std::string &type, SequenceFeatureSet &features) void getFeaturesOfSequence classbpp_1_1GtfFeatureReader.html a41325d7b9a4b37f3ad5602ba1628e395 (const std::string &seqId, SequenceFeatureSet &features) static const std::string GTF_PHASE classbpp_1_1GtfFeatureReader.html ad32b3f466339fc8dca0265a68720a178 static const std::string GTF_GENE_ID classbpp_1_1GtfFeatureReader.html a1828bc7bbfb73df1ccabc1facbf3ff79 static const std::string GTF_TRANSCRIPT_ID classbpp_1_1GtfFeatureReader.html a831f2b2c7673013cc4d22f891bd387ed GtfFeatureReader classbpp_1_1GtfFeatureReader.html a41fc89cb6fdda99484cefcb38bdf8115 (const GtfFeatureReader &reader) GtfFeatureReader & operator= classbpp_1_1GtfFeatureReader.html a14d1653cbb6fe85a617954c809d04990 (const GtfFeatureReader &reader) void getNextLine_ classbpp_1_1GtfFeatureReader.html ac798c5b29b4e822bc5ed2b363dd4fd41 () std::istream * input_ classbpp_1_1GtfFeatureReader.html a346b9f1e177cf672c5004ebae78c3ab9 std::string nextLine_ classbpp_1_1GtfFeatureReader.html acd97df52b7de4d5f557977b5f6de7e7c bpp::SeqRange classbpp_1_1SeqRange.html Range< size_t > SeqRange classbpp_1_1SeqRange.html aff5cebb974ae3f97919fa4e134a2410d (size_t a, size_t b, char strand= '.') SeqRange * clone classbpp_1_1SeqRange.html a3d290bc8b82fc16bfe7aac1146fbf1c9 () const virtual char getStrand classbpp_1_1SeqRange.html a47c20df24e12d67132bbc0be826282b3 () const virtual bool isNegativeStrand classbpp_1_1SeqRange.html ab90fe5f0974596a3ae9d0bc6b304f010 () const virtual bool isStranded classbpp_1_1SeqRange.html a53e3ae2c8546c25e3f91ac605215197a () const virtual void invert classbpp_1_1SeqRange.html a8fd58d326e463c444e969362a123132c () char strand_ classbpp_1_1SeqRange.html a8287a511d5f7f7854a9ad13eed2824fc bpp::SequenceFeature classbpp_1_1SequenceFeature.html bpp::Clonable virtual SequenceFeature * clone classbpp_1_1SequenceFeature.html a4355009daa3f7f0555ef0d170e908348 () const =0 virtual const std::string & getId classbpp_1_1SequenceFeature.html a8b139fc4ef17a12c9716176a96b572b0 () const =0 virtual void setId classbpp_1_1SequenceFeature.html a060a1d0b951d1f8e409e247e7bf18825 (const std::string &id)=0 virtual const std::string & getSequenceId classbpp_1_1SequenceFeature.html a968226af5f42ed289861854be2ab1cf3 () const =0 virtual void setSequenceId classbpp_1_1SequenceFeature.html a69229d23bfbb7c3dce5c58ef283fe3cb (const std::string &id)=0 virtual const std::string & getSource classbpp_1_1SequenceFeature.html a63c59c73b779e4cab4d74de18da92dfb () const =0 virtual void setSource classbpp_1_1SequenceFeature.html ac00a826fad9b0aec3b8f3f851587a8ca (const std::string &source)=0 virtual const std::string & getType classbpp_1_1SequenceFeature.html a06fc02d9aacf9af2751e54f492c3de6c () const =0 virtual void setType classbpp_1_1SequenceFeature.html ac2249769626ca102fe2367d46f715a4a (const std::string &type)=0 virtual const size_t getStart classbpp_1_1SequenceFeature.html a9551fc9156e151d001bd974a566dff83 () const =0 virtual const size_t getEnd classbpp_1_1SequenceFeature.html a66782e76929622593269257b5a13f788 () const =0 virtual bool isStranded classbpp_1_1SequenceFeature.html a6a82f86f5cbbbc794de0bb598e2f8562 () const =0 virtual bool isNegativeStrand classbpp_1_1SequenceFeature.html ada7790e41b26d626dca38730f3a5655f () const =0 virtual void invert classbpp_1_1SequenceFeature.html a0a14e70dab4475b0306a93e446e706e7 ()=0 virtual SeqRange getRange classbpp_1_1SequenceFeature.html a06e4a1b0fcff2c387f99565e81f6c080 () const =0 virtual bool overlap classbpp_1_1SequenceFeature.html a6dcad6cb61d3995d9d3d954e4e065dde (const SequenceFeature &feat) const =0 virtual const double & getScore classbpp_1_1SequenceFeature.html ab1b4c79a3dcc65ed2d14c0b8078abe47 () const =0 virtual void setScore classbpp_1_1SequenceFeature.html a8831e0d9998f8d908131e49b78c7bfae (double score)=0 virtual const std::string & getAttribute classbpp_1_1SequenceFeature.html a7387df483620f928a16a685f1678ba21 (const std::string &attribute) const =0 virtual std::string & getAttribute classbpp_1_1SequenceFeature.html acb055a714d3a3c186b1c54a7ff08fe5f (const std::string &attribute)=0 virtual std::set< std::string > getAttributeList classbpp_1_1SequenceFeature.html a02552229e48add06f81e3fbef9964658 () const =0 virtual void setAttribute classbpp_1_1SequenceFeature.html a85642d04392a129f3164744df6be95c5 (const std::string &attribute, const std::string &value)=0 virtual void removeAttribute classbpp_1_1SequenceFeature.html a59d79e62554f3b78b2fe5fff8ff824c6 (const std::string &attribute)=0 static const std::string NO_ATTRIBUTE_SET classbpp_1_1SequenceFeature.html a7e379a0be1068b348c870b7089fc8c44 bpp::BasicSequenceFeature classbpp_1_1BasicSequenceFeature.html bpp::SequenceFeature BasicSequenceFeature classbpp_1_1BasicSequenceFeature.html abf98f177d2dfb743c6b0afb36b39b7a9 (const std::string &id, const std::string &seqId, const std::string &source, const std::string &type, size_t start, size_t end, char strand, double score=-1) virtual BasicSequenceFeature * clone classbpp_1_1BasicSequenceFeature.html a32794ea2cfc68366e258118a81671c38 () const const std::string & getId classbpp_1_1BasicSequenceFeature.html a30849237d8c128c281f7b63576e019e1 () const void setId classbpp_1_1BasicSequenceFeature.html ab1ae6461d9f79bd23018f19e0ceade05 (const std::string &id) const std::string & getSequenceId classbpp_1_1BasicSequenceFeature.html ac1d2b9955faa4922942d52af6ff089c9 () const void setSequenceId classbpp_1_1BasicSequenceFeature.html ab6b55068a5f11c6d6c1f7c629a10988d (const std::string &sid) const std::string & getSource classbpp_1_1BasicSequenceFeature.html a19782439633a0b82bbc12a77c99d965d () const void setSource classbpp_1_1BasicSequenceFeature.html ada1769de6c66daf58e9d85edc822f37f (const std::string &source) const std::string & getType classbpp_1_1BasicSequenceFeature.html af47c7160debad48595d6994c7288b72f () const void setType classbpp_1_1BasicSequenceFeature.html ae6827744cb9f5ab44d56e0acd9a7698d (const std::string &type) const size_t getStart classbpp_1_1BasicSequenceFeature.html afdf074bc00813d994b6836fa1a9dd28c () const const size_t getEnd classbpp_1_1BasicSequenceFeature.html a54558378a3ee196b8a9eeab33674bb8d () const bool isStranded classbpp_1_1BasicSequenceFeature.html aedffe85efb405c0363ccbaad6becc3f2 () const bool isNegativeStrand classbpp_1_1BasicSequenceFeature.html ac3822ed54ea5c4e5aeb9f4c33c5f1383 () const void invert classbpp_1_1BasicSequenceFeature.html a706ddb77da20e84f22e8ef3e53a095ab () const double & getScore classbpp_1_1BasicSequenceFeature.html a789679ad7f26afa7003b4ed7ad48b5b7 () const void setScore classbpp_1_1BasicSequenceFeature.html ae763b51216b0a101ab9db8dd5274d2c2 (double score) const std::string & getAttribute classbpp_1_1BasicSequenceFeature.html a0b4b05de971d4ffc4d4539a9b8e5532c (const std::string &attribute) const std::string & getAttribute classbpp_1_1BasicSequenceFeature.html a73a2712730ed2ac1f3eb973e9e0f632b (const std::string &attribute) void setAttribute classbpp_1_1BasicSequenceFeature.html a0f9efc49df4c1320e7101e21b023f45a (const std::string &attribute, const std::string &value) std::set< std::string > getAttributeList classbpp_1_1BasicSequenceFeature.html ae87d58ae25dec173bc3b2b7f456185ef () const void removeAttribute classbpp_1_1BasicSequenceFeature.html a4fa9f3c0d2184ebdaca24ed984361665 (const std::string &attribute) SeqRange getRange classbpp_1_1BasicSequenceFeature.html a50a8df30a52bf18e958e0c162e520ea6 () const bool overlap classbpp_1_1BasicSequenceFeature.html a606d3131eb826f0753dac6bd25d430cb (const SequenceFeature &feat) const std::string id_ classbpp_1_1BasicSequenceFeature.html a650179fecc2735ceaea445afc32018b2 std::string sequenceId_ classbpp_1_1BasicSequenceFeature.html a0ff790a68341e499d9f853c8ef36583e std::string source_ classbpp_1_1BasicSequenceFeature.html a922fce6eaf93184afc9ff366f836e901 std::string type_ classbpp_1_1BasicSequenceFeature.html a0dc1537fd581723a8e759f22b7772ecf SeqRange range_ classbpp_1_1BasicSequenceFeature.html ad5e89a6911b57144dbb9d3ff17536f78 double score_ classbpp_1_1BasicSequenceFeature.html a4fb84ce524ed1f0ce6bcb01e7d8d131e std::map< std::string, std::string > attributes_ classbpp_1_1BasicSequenceFeature.html a7d3bab9246297e70ed437d009feb9814 bpp::SequenceFeatureSet classbpp_1_1SequenceFeatureSet.html SequenceFeatureSet classbpp_1_1SequenceFeatureSet.html ab8942cfbb63599ad1c3b2d7318848a08 () virtual ~SequenceFeatureSet classbpp_1_1SequenceFeatureSet.html a297778c2e58d6a4192f286e1f53f6ce9 () SequenceFeatureSet classbpp_1_1SequenceFeatureSet.html a9c99c725bec10fbf6a2789c80eef862b (const SequenceFeatureSet &sfs) SequenceFeatureSet & operator= classbpp_1_1SequenceFeatureSet.html a7aac9604b8f19c0f57e0831e8b901b7b (const SequenceFeatureSet &sfs) void clear classbpp_1_1SequenceFeatureSet.html a8afcf5654962bf6b5a19ebe50b0075cd () const SequenceFeature & getFeature classbpp_1_1SequenceFeatureSet.html ad2727c815f124ba7822e1b4711d3b0c9 (size_t i) const const SequenceFeature & operator[] classbpp_1_1SequenceFeatureSet.html ada1e8d7c435f6bcc93b12553db5c4f81 (size_t i) const size_t getNumberOfFeatures classbpp_1_1SequenceFeatureSet.html a27d0694729d8eda79431632c1beed9e5 () const void addFeature classbpp_1_1SequenceFeatureSet.html a5d40ce4d24c87b71b37ceb79f3b2cbc5 (const SequenceFeature &feature) std::set< std::string > getSequences classbpp_1_1SequenceFeatureSet.html a4a090f1887e6ed19ef9ef8af0c80c66c () const std::set< std::string > getTypes classbpp_1_1SequenceFeatureSet.html a105dd4ce3ed5b78bc0e57fb931753bc4 () const void fillRangeCollectionForSequence classbpp_1_1SequenceFeatureSet.html adc0d767d0ecf55f750a6a5d7742d664f (const std::string &seqId, RangeCollection< size_t > &coords) const SequenceFeatureSet * getSubsetForType classbpp_1_1SequenceFeatureSet.html a3d0e0a6e35fbc255248b68aebd728507 (const std::vector< std::string > &types) const std::vector< SequenceFeature * > features_ classbpp_1_1SequenceFeatureSet.html a661b0403f4bd4875849fe2b21fa37435 bpp::SequenceFeatureTools classbpp_1_1SequenceFeatureTools.html static Sequence * extract classbpp_1_1SequenceFeatureTools.html a3323edd28fc94a4200d106d349b35729 (const Sequence &seq, const SeqRange &range) static unsigned int getOrfs classbpp_1_1SequenceFeatureTools.html a698da40b581c6e4c60053509f1d8e56b (const Sequence &seq, SequenceFeatureSet &featSet, const GeneticCode &gCode) bpp::Fastq classbpp_1_1Fastq.html bpp::ISequenceStream bpp::OSequenceStream Fastq classbpp_1_1Fastq.html a512179a4db78a0c74c2c33621e2aed31 (bool repName=false) virtual ~Fastq classbpp_1_1Fastq.html ab1511fcf73fcb81b63a98bf0a10b46c0 () bool repeatName classbpp_1_1Fastq.html a74fa2c88d51c73e70f3ed3b61b954ca9 () const void repeatName classbpp_1_1Fastq.html a5bd3f165dab7ffeca595cecd0e18c127 (bool yn) const std::string getFormatName classbpp_1_1Fastq.html ad4254b28d0120aac561d2cf1c2f8ce7e () const const std::string getFormatDescription classbpp_1_1Fastq.html ad8f6a6dee6024f4f8a18f9895ae218c8 () const const std::string getDataType classbpp_1_1Fastq.html a3f2fbd6446bc706e5f3b16fe0937bfc1 () const bool nextSequence classbpp_1_1Fastq.html a12420e184abc864f91ccab29382c79d5 (std::istream &input, Sequence &seq) const void writeSequence classbpp_1_1Fastq.html aee05b33881bcff74caa45ca1123ee2ea (std::ostream &output, const Sequence &seq) const bool repeatName_ classbpp_1_1Fastq.html af2970097a8bd5b6ea428e3c9a924beae bpp::AlignmentFilterMafIterator classbpp_1_1AlignmentFilterMafIterator.html bpp::AbstractFilterMafIterator bpp::MafTrashIterator AlignmentFilterMafIterator classbpp_1_1AlignmentFilterMafIterator.html a379b41b87d003975fbe7ef1eb710926e (MafIterator *iterator, const std::vector< std::string > &species, unsigned int windowSize, unsigned int step, unsigned int maxGap, double maxEnt, bool keepTrashedBlocks, bool missingAsGap) MafBlock * nextRemovedBlock classbpp_1_1AlignmentFilterMafIterator.html ac42c4979cf1fe11fb31dbb828156c723 () void setLogStream classbpp_1_1AbstractFilterMafIterator.html a389963ab369676232b41c99113a46959 (OutputStream *logstream) void addIterationListener classbpp_1_1AbstractMafIterator.html ada15b9800bc26360af61d49f5606fe5b (IterationListener *listener) MafBlock * nextBlock classbpp_1_1AbstractMafIterator.html a4be87218e557f149290880b29c1c2875 () bool isVerbose classbpp_1_1AbstractMafIterator.html aaf877fb4c7a985e6a11dc48f474f785a () const void setVerbose classbpp_1_1AbstractMafIterator.html ac5e8064022a91149335e5410a709bf3c (bool yn) virtual void fireIterationStartSignal_ classbpp_1_1AbstractMafIterator.html ac02bfa093b9f09fc774328b6acc43aff () virtual void fireIterationMoveSignal_ classbpp_1_1AbstractMafIterator.html a0b8d32b4d1c258e092c4085e8f609580 (const MafBlock &currentBlock) virtual void fireIterationStopSignal_ classbpp_1_1AbstractMafIterator.html acf46a95727a541b1a71ce596074e5bf6 () MafIterator * iterator_ classbpp_1_1AbstractFilterMafIterator.html a12df514a176aebdf5fe5fabf467b51ae MafBlock * currentBlock_ classbpp_1_1AbstractFilterMafIterator.html aa76bc0ccee871325e82adc7c1bb1f7c7 OutputStream * logstream_ classbpp_1_1AbstractFilterMafIterator.html a7731cc8e9be41760d962867d0c7ea226 std::vector< IterationListener * > iterationListeners_ classbpp_1_1AbstractMafIterator.html afea0d071192a02bb659d22e0511b8ed7 bool started_ classbpp_1_1AbstractMafIterator.html ad18a9bd97b1cb246d44afe55dd5f9e1f bool verbose_ classbpp_1_1AbstractMafIterator.html ae0ba6b4d04b6cf1bd81c264904323207 MafBlock * analyseCurrentBlock_ classbpp_1_1AlignmentFilterMafIterator.html ab96b63c37b51fa12e173d5abf48e9721 () std::vector< std::string > species_ classbpp_1_1AlignmentFilterMafIterator.html af9d87927d7c0d4f3e0c5fc2867ec6196 unsigned int windowSize_ classbpp_1_1AlignmentFilterMafIterator.html a9e529cea99e15ed429687e159129d076 unsigned int step_ classbpp_1_1AlignmentFilterMafIterator.html a1a59ed63f26f4adafce2d2d7ad02087b unsigned int maxGap_ classbpp_1_1AlignmentFilterMafIterator.html ac79a4eb852bdb86ac0f042af9f926d4a double maxEnt_ classbpp_1_1AlignmentFilterMafIterator.html acc3c5d31ddcc105533164e16ee10e19d std::deque< MafBlock * > blockBuffer_ classbpp_1_1AlignmentFilterMafIterator.html a0a08f15cacffd3d236fda0fdfbe17880 std::deque< MafBlock * > trashBuffer_ classbpp_1_1AlignmentFilterMafIterator.html aab1128693a3fcdf839e96263a7717b66 std::deque< std::vector< int > > window_ classbpp_1_1AlignmentFilterMafIterator.html a46e8b21890adf8014000e9ed99717081 bool keepTrashedBlocks_ classbpp_1_1AlignmentFilterMafIterator.html a820e36a63cc043e8193d39f2e3e6f3b0 bool missingAsGap_ classbpp_1_1AlignmentFilterMafIterator.html a680c4851b1afc7626012b658fd334f3c bpp::AlignmentFilter2MafIterator classbpp_1_1AlignmentFilter2MafIterator.html bpp::AbstractFilterMafIterator bpp::MafTrashIterator AlignmentFilter2MafIterator classbpp_1_1AlignmentFilter2MafIterator.html a0e056d893541e4b141c310282f3a1776 (MafIterator *iterator, const std::vector< std::string > &species, unsigned int windowSize, unsigned int step, unsigned int maxGap, unsigned int maxPos, bool keepTrashedBlocks, bool missingAsGap) MafBlock * nextRemovedBlock classbpp_1_1AlignmentFilter2MafIterator.html a5715ff37c41faf67dfae9741126b7d2b () MafBlock * analyseCurrentBlock_ classbpp_1_1AlignmentFilter2MafIterator.html a5cabc640612e1917d9ff305343516603 () std::vector< std::string > species_ classbpp_1_1AlignmentFilter2MafIterator.html a195608245d8f9e651dbcbc26f789b314 unsigned int windowSize_ classbpp_1_1AlignmentFilter2MafIterator.html a89b07d92df83e2bb31e35d5601326d23 unsigned int step_ classbpp_1_1AlignmentFilter2MafIterator.html acd7892c41727d184a7862909bda13691 unsigned int maxGap_ classbpp_1_1AlignmentFilter2MafIterator.html a3d9c81495702e2c03b75403eff6813b4 unsigned int maxPos_ classbpp_1_1AlignmentFilter2MafIterator.html a78ebecac5f397fd61046dcf135b38ea4 std::deque< MafBlock * > blockBuffer_ classbpp_1_1AlignmentFilter2MafIterator.html aca3d81df6cc8f3223d52605a6a8eaf23 std::deque< MafBlock * > trashBuffer_ classbpp_1_1AlignmentFilter2MafIterator.html ae61977e35ed390a9fca18cd9fe31b2a0 std::deque< std::vector< bool > > window_ classbpp_1_1AlignmentFilter2MafIterator.html a3db4195caca2ec9ab500ec17f85883ab bool keepTrashedBlocks_ classbpp_1_1AlignmentFilter2MafIterator.html a09c677c300136a46e390117ca8655f08 bool missingAsGap_ classbpp_1_1AlignmentFilter2MafIterator.html a26d365803d0b1fefc361a973a6ff9fd9 bpp::BlockLengthMafIterator classbpp_1_1BlockLengthMafIterator.html bpp::AbstractFilterMafIterator BlockLengthMafIterator classbpp_1_1BlockLengthMafIterator.html a3ecb52571c53f99baabedf84c2c3f8ee (MafIterator *iterator, size_t minLength) MafBlock * analyseCurrentBlock_ classbpp_1_1BlockLengthMafIterator.html a4d704fad20906b450f17b35e466909ce () size_t minLength_ classbpp_1_1BlockLengthMafIterator.html afdc703e4dbf2a0e77bd73a94bc2ebcda bpp::BlockMergerMafIterator classbpp_1_1BlockMergerMafIterator.html bpp::AbstractFilterMafIterator BlockMergerMafIterator classbpp_1_1BlockMergerMafIterator.html a69a868b6da810089e3685e575b4904f5 (MafIterator *iterator, const std::vector< std::string > &species, unsigned int maxDist=0) void ignoreChromosome classbpp_1_1BlockMergerMafIterator.html aa9522ef8d5bc9747c48cd1d83bec74ff (const std::string &chr) BlockMergerMafIterator classbpp_1_1BlockMergerMafIterator.html a245cd31bd4e67cb081b5d9fc65c548a1 (const BlockMergerMafIterator &iterator) BlockMergerMafIterator & operator= classbpp_1_1BlockMergerMafIterator.html afca2bca822c4c73448c3cacd6be1b3d1 (const BlockMergerMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1BlockMergerMafIterator.html a07e1f5d264dbaa32f5cbdc2c955903f2 () std::vector< std::string > species_ classbpp_1_1BlockMergerMafIterator.html a54a94fca504659834110d6a3d7c4d84c MafBlock * incomingBlock_ classbpp_1_1BlockMergerMafIterator.html a956160584be4b9a965833e49382f7dbb std::vector< std::string > ignoreChrs_ classbpp_1_1BlockMergerMafIterator.html aa3590f6b9ed861aa48d23835957defa0 unsigned int maxDist_ classbpp_1_1BlockMergerMafIterator.html a36d02a67be4f084eea927624425b0a9e bpp::BlockSizeMafIterator classbpp_1_1BlockSizeMafIterator.html bpp::AbstractFilterMafIterator BlockSizeMafIterator classbpp_1_1BlockSizeMafIterator.html ab10c41e64dfddb9242da236e1c8289d0 (MafIterator *iterator, unsigned int minSize) MafBlock * analyseCurrentBlock_ classbpp_1_1BlockSizeMafIterator.html af0a5aa3f1e9607dd48d6c8d5a26276a1 () unsigned int minSize_ classbpp_1_1BlockSizeMafIterator.html a29ecd8e5ee4e648fc8bbad516b6e7865 bpp::ChromosomeMafIterator classbpp_1_1ChromosomeMafIterator.html bpp::AbstractFilterMafIterator ChromosomeMafIterator classbpp_1_1ChromosomeMafIterator.html a72403af4b33ee291289fdf3bd26c5e5c (MafIterator *iterator, const std::string &reference, const std::string &chr) ChromosomeMafIterator classbpp_1_1ChromosomeMafIterator.html aca0b3a7ddbad77d3191a354e6ddc71b5 (const ChromosomeMafIterator &iterator) ChromosomeMafIterator & operator= classbpp_1_1ChromosomeMafIterator.html a088ee90e9dec8fef23ecbe7f578e51e2 (const ChromosomeMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1ChromosomeMafIterator.html a1b20c4d56ccc1e98ae3ea1e6b63dd538 () std::string ref_ classbpp_1_1ChromosomeMafIterator.html ad46d71970c10c37b16ed71b2671e04e9 std::string chr_ classbpp_1_1ChromosomeMafIterator.html ab3f4162afc38a03d1bb01ed22dcf9ee2 bpp::ConcatenateMafIterator classbpp_1_1ConcatenateMafIterator.html bpp::AbstractFilterMafIterator ConcatenateMafIterator classbpp_1_1ConcatenateMafIterator.html a2b690f3c5260e1cb49b3751aa1b5d783 (MafIterator *iterator, unsigned int minimumSize) ConcatenateMafIterator classbpp_1_1ConcatenateMafIterator.html a2a61be291a57d5d9386e66d2a205db33 (const ConcatenateMafIterator &iterator) ConcatenateMafIterator & operator= classbpp_1_1ConcatenateMafIterator.html aa54f4b3e2e417de1b22a27cf0ee57ee5 (const ConcatenateMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1ConcatenateMafIterator.html a4be5783dee6973c6a3509dfc1be7d944 () MafBlock * incomingBlock_ classbpp_1_1ConcatenateMafIterator.html a737e7c3950950474af018145a32421d8 unsigned int minimumSize_ classbpp_1_1ConcatenateMafIterator.html a7c47a45d79400586c751c904a32be80f bpp::CoordinatesOutputMafIterator classbpp_1_1CoordinatesOutputMafIterator.html bpp::AbstractFilterMafIterator CoordinatesOutputMafIterator classbpp_1_1CoordinatesOutputMafIterator.html ac656955da53b34585fed8f3700e6cf02 (MafIterator *iterator, std::ostream *out, const std::vector< std::string > &species) CoordinatesOutputMafIterator classbpp_1_1CoordinatesOutputMafIterator.html ab8248d175d4ec2879ccc4f8dcc343475 (const CoordinatesOutputMafIterator &iterator) CoordinatesOutputMafIterator & operator= classbpp_1_1CoordinatesOutputMafIterator.html a56ff5e8f2048a222fdf89d9f924c3481 (const CoordinatesOutputMafIterator &iterator) void writeHeader_ classbpp_1_1CoordinatesOutputMafIterator.html a15dc1c23214d710e724b6d4ef5f6e091 (std::ostream &out) const MafBlock * analyseCurrentBlock_ classbpp_1_1CoordinatesOutputMafIterator.html afb24e74507cfe9697767e86e6b9b0454 () std::ostream * output_ classbpp_1_1CoordinatesOutputMafIterator.html afe154af561a828d0e5ea76ccb6e3cfd9 std::vector< std::string > species_ classbpp_1_1CoordinatesOutputMafIterator.html a345cf2105bdc7b3da4d6db4553f35811 bpp::DuplicateFilterMafIterator classbpp_1_1DuplicateFilterMafIterator.html bpp::AbstractFilterMafIterator DuplicateFilterMafIterator classbpp_1_1DuplicateFilterMafIterator.html a641c64d5216abc7c26475f207288e176 (MafIterator *iterator, const std::string &reference) DuplicateFilterMafIterator classbpp_1_1DuplicateFilterMafIterator.html a3804c0fcf1f0bf9f4c4ea6df52b82015 (const DuplicateFilterMafIterator &iterator) DuplicateFilterMafIterator & operator= classbpp_1_1DuplicateFilterMafIterator.html a3c657275786fc64e241fa2becbe3abe3 (const DuplicateFilterMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1DuplicateFilterMafIterator.html aa77d33c5bd29147e3fd25613eb73d34d () std::string ref_ classbpp_1_1DuplicateFilterMafIterator.html a671adb17aebd9816cef252161db42f95 std::map< std::string, std::map< char, std::map< size_t, std::map< size_t, size_t > > > > blocks_ classbpp_1_1DuplicateFilterMafIterator.html ab55e2427e8e4bca6d4ddf0b2c1d77772 bpp::EntropyFilterMafIterator classbpp_1_1EntropyFilterMafIterator.html bpp::AbstractFilterMafIterator bpp::MafTrashIterator EntropyFilterMafIterator classbpp_1_1EntropyFilterMafIterator.html a93fce01b437cf189d0d2a760544c1557 (MafIterator *iterator, const std::vector< std::string > &species, unsigned int windowSize, unsigned int step, double maxEnt, unsigned int maxPos, bool keepTrashedBlocks, bool missingAsGap, bool ignoreGaps) MafBlock * nextRemovedBlock classbpp_1_1EntropyFilterMafIterator.html a7f9c77062b219fe386782f3fbc556950 () MafBlock * analyseCurrentBlock_ classbpp_1_1EntropyFilterMafIterator.html a5c827d45eba78fae15cd7402223ab09d () std::vector< std::string > species_ classbpp_1_1EntropyFilterMafIterator.html a56324d9c8e3c27402868c5d080262557 unsigned int windowSize_ classbpp_1_1EntropyFilterMafIterator.html ac9465d815f54f8eb6944c2a9db05c0c6 unsigned int step_ classbpp_1_1EntropyFilterMafIterator.html a4d7e99a6f8677a0f7b7d2ad43a7402d8 double maxEnt_ classbpp_1_1EntropyFilterMafIterator.html a33b8e125bf87b379f52738cb591b6d95 unsigned int maxPos_ classbpp_1_1EntropyFilterMafIterator.html a712f9a0986f70be1509abd0d44b4dfa9 std::deque< MafBlock * > blockBuffer_ classbpp_1_1EntropyFilterMafIterator.html ab6e27d2373950ccdc30c5a0ab9daeb18 std::deque< MafBlock * > trashBuffer_ classbpp_1_1EntropyFilterMafIterator.html a0df98e22f973df32e7af79f3fb957b44 std::deque< unsigned int > window_ classbpp_1_1EntropyFilterMafIterator.html a51146e1abb7f06f86cc78651d004e5dd bool keepTrashedBlocks_ classbpp_1_1EntropyFilterMafIterator.html a1236c31179002df570bab9dc549bc7f2 bool missingAsGap_ classbpp_1_1EntropyFilterMafIterator.html a802d842b687b193c0fe648baf73a68b0 bool ignoreGaps_ classbpp_1_1EntropyFilterMafIterator.html a89981c1c5182f3b6460d7fa56c9c5d66 bpp::FeatureExtractor classbpp_1_1FeatureExtractor.html bpp::AbstractFilterMafIterator FeatureExtractor classbpp_1_1FeatureExtractor.html a50fa28564894b96042e4c3621774a8b8 (MafIterator *iterator, const std::string &refSpecies, const SequenceFeatureSet &features, bool complete=false, bool ignoreStrand=false) MafBlock * analyseCurrentBlock_ classbpp_1_1FeatureExtractor.html af36e1109483526c7c1acf83981ce4b97 () std::string refSpecies_ classbpp_1_1FeatureExtractor.html a681e3fc83f3b5ea1d7bd661a56269787 bool completeOnly_ classbpp_1_1FeatureExtractor.html a822de737215c3154e796110773fc606b bool ignoreStrand_ classbpp_1_1FeatureExtractor.html a6908b991b3e1be5c360890ced35be2d4 std::deque< MafBlock * > blockBuffer_ classbpp_1_1FeatureExtractor.html acce583418797392da14672d80124f430 std::map< std::string, RangeSet< size_t > > ranges_ classbpp_1_1FeatureExtractor.html a03bd69422d929bf366a40597b7c48b69 bpp::FeatureFilterMafIterator classbpp_1_1FeatureFilterMafIterator.html bpp::AbstractFilterMafIterator bpp::MafTrashIterator FeatureFilterMafIterator classbpp_1_1FeatureFilterMafIterator.html a92aca33669a2ba69b6336d570eb0077e (MafIterator *iterator, const std::string &refSpecies, const SequenceFeatureSet &features, bool keepTrashedBlocks) MafBlock * nextRemovedBlock classbpp_1_1FeatureFilterMafIterator.html adaf99e7c9f135b7e5b80b845708cc976 () MafBlock * analyseCurrentBlock_ classbpp_1_1FeatureFilterMafIterator.html a91c603d3dcc261fb24765d8bcdfcffe9 () std::string refSpecies_ classbpp_1_1FeatureFilterMafIterator.html a69eaa99425664d448d3ffa4fd83660fd std::deque< MafBlock * > blockBuffer_ classbpp_1_1FeatureFilterMafIterator.html a65174928ff4120452e5f1c48695018ac std::deque< MafBlock * > trashBuffer_ classbpp_1_1FeatureFilterMafIterator.html afcbec374d5de10e0957579cbcfb2d278 bool keepTrashedBlocks_ classbpp_1_1FeatureFilterMafIterator.html a29524e4a2489fc0de99b75a2c6fe3a51 std::map< std::string, MultiRange< size_t > > ranges_ classbpp_1_1FeatureFilterMafIterator.html a52f0ff249b4694bb6352ac27801bc42f bpp::FullGapFilterMafIterator classbpp_1_1FullGapFilterMafIterator.html bpp::AbstractFilterMafIterator FullGapFilterMafIterator classbpp_1_1FullGapFilterMafIterator.html a7e8c504dd3205e9a0ce21236e665d0ae (MafIterator *iterator, const std::vector< std::string > &species) MafBlock * analyseCurrentBlock_ classbpp_1_1FullGapFilterMafIterator.html a10cb42b446d944f90bdc38dc3b649c4f () std::vector< std::string > species_ classbpp_1_1FullGapFilterMafIterator.html ac63cb122ead50f6cc50dabfc171c6991 bpp::IterationListener classbpp_1_1IterationListener.html virtual ~IterationListener classbpp_1_1IterationListener.html ac1939c7253ef1bd1d744b85941c8a297 () virtual void iterationStarts classbpp_1_1IterationListener.html ad5d837eb71b6b2f4d6f2a1da83c674de ()=0 virtual void iterationMoves classbpp_1_1IterationListener.html aa21e2e9b0acbc9f59429c2623ca1b9a1 (const MafBlock &currentBlock)=0 virtual void iterationStops classbpp_1_1IterationListener.html a2d4ad3a417786b4b25120a612ae6449d ()=0 bpp::AbstractStatisticsOutputIterationListener classbpp_1_1AbstractStatisticsOutputIterationListener.html bpp::IterationListener AbstractStatisticsOutputIterationListener classbpp_1_1AbstractStatisticsOutputIterationListener.html a9bb6fd60ad7312ab52d833e3b08e23c7 (SequenceStatisticsMafIterator *iterator) AbstractStatisticsOutputIterationListener classbpp_1_1AbstractStatisticsOutputIterationListener.html ab0e49c7167b586381e90c6b56539a27a (const AbstractStatisticsOutputIterationListener &listener) AbstractStatisticsOutputIterationListener & operator= classbpp_1_1AbstractStatisticsOutputIterationListener.html a36d935f57c5f12f74b0261997bd28daa (const AbstractStatisticsOutputIterationListener &listener) virtual ~AbstractStatisticsOutputIterationListener classbpp_1_1AbstractStatisticsOutputIterationListener.html a92bf3dcce4d658623bd8b58e3e9e4350 () SequenceStatisticsMafIterator * statsIterator_ classbpp_1_1AbstractStatisticsOutputIterationListener.html af479520b0736101b73d75f0076e53cd3 bpp::CsvStatisticsOutputIterationListener classbpp_1_1CsvStatisticsOutputIterationListener.html bpp::AbstractStatisticsOutputIterationListener CsvStatisticsOutputIterationListener classbpp_1_1CsvStatisticsOutputIterationListener.html a06b59b97ff38f56204228d96cfa637b9 (SequenceStatisticsMafIterator *iterator, const std::string &refSpecies, OutputStream *output, const std::string &sep="\t") CsvStatisticsOutputIterationListener classbpp_1_1CsvStatisticsOutputIterationListener.html a26f59fcb5e87d0bd4816572209db11f9 (const CsvStatisticsOutputIterationListener &listener) CsvStatisticsOutputIterationListener & operator= classbpp_1_1CsvStatisticsOutputIterationListener.html ae6f6d4b98c94092258795b15005c40d3 (const CsvStatisticsOutputIterationListener &listener) virtual ~CsvStatisticsOutputIterationListener classbpp_1_1CsvStatisticsOutputIterationListener.html a906f84f228ee54493b0c660aaa77599d () virtual void iterationStarts classbpp_1_1CsvStatisticsOutputIterationListener.html a557f80a0f9b7d2eaf2911e0ddc8f3558 () virtual void iterationMoves classbpp_1_1CsvStatisticsOutputIterationListener.html ad524d3447493464f968878e649a8e2e9 (const MafBlock &currentBlock) virtual void iterationStops classbpp_1_1CsvStatisticsOutputIterationListener.html a99b75e6decff6d5c9dbef6c83c618705 () OutputStream * output_ classbpp_1_1CsvStatisticsOutputIterationListener.html a0ec4c2f04700d35f73f86ec2b05fd14f std::string sep_ classbpp_1_1CsvStatisticsOutputIterationListener.html a7613da40c31d3a1577c296a81f424de9 std::string refSpecies_ classbpp_1_1CsvStatisticsOutputIterationListener.html a703f6ee372824c334f2eed8fd53dd004 bpp::MafBlock classbpp_1_1MafBlock.html bpp::Clonable MafBlock classbpp_1_1MafBlock.html a058642cef3fefccaa37ad94c4366a888 () MafBlock classbpp_1_1MafBlock.html ae2bd5c7fdb9585536fe0d1851b7d05a6 (const MafBlock &block) MafBlock & operator= classbpp_1_1MafBlock.html a10ce330f5e6192c1f1dde10469568bab (const MafBlock &block) MafBlock * clone classbpp_1_1MafBlock.html a39812e3de82ef1c7d5a68c67d627ac96 () const virtual ~MafBlock classbpp_1_1MafBlock.html a9334610bb793811865e8b1657181e7cd () void setScore classbpp_1_1MafBlock.html a2bf88e7b9ebe30f2b8388006b71ed424 (double score) void setPass classbpp_1_1MafBlock.html a3fd86ff8e8216ff3d60483a483018605 (unsigned int pass) double getScore classbpp_1_1MafBlock.html af19c3566a11f04a49adfb30a30b8941f () const unsigned int getPass classbpp_1_1MafBlock.html acccf24c02a5de3496efad036c1173bba () const AlignedSequenceContainer & getAlignment classbpp_1_1MafBlock.html a9dc1711c5607219d03bc3470ad70c91e () const AlignedSequenceContainer & getAlignment classbpp_1_1MafBlock.html a78ca490c256ff0eb652eb35cb2dc016d () const size_t getNumberOfSequences classbpp_1_1MafBlock.html af2520910770075b2f938a3481a115dd2 () const size_t getNumberOfSites classbpp_1_1MafBlock.html a84d6c4b723e3a4cb6f6b981bd0f1f997 () const void addSequence classbpp_1_1MafBlock.html a9e5084810c7463855698ef5148a274ad (const MafSequence &sequence) bool hasSequence classbpp_1_1MafBlock.html a47b11e4d976f20d96641ecc00a183c4b (const std::string &name) const const MafSequence & getSequence classbpp_1_1MafBlock.html a9bcfc8036897c9a0a6cafe2031582645 (const std::string &name) const const MafSequence & getSequence classbpp_1_1MafBlock.html abed0e86dd2b81c767d96b5e37be2beb1 (size_t i) const bool hasSequenceForSpecies classbpp_1_1MafBlock.html a34f41c2e154a97b0e62a3fe429f09b8f (const std::string &species) const const MafSequence & getSequenceForSpecies classbpp_1_1MafBlock.html a5c05243dba43f35ceefad861a1da8054 (const std::string &species) const std::vector< const MafSequence * > getSequencesForSpecies classbpp_1_1MafBlock.html a487ca618040aa36aa0fe216d8a6d6074 (const std::string &species) const std::vector< std::string > getSpeciesList classbpp_1_1MafBlock.html a7b75cbad1316162a4b8ab32cd6e21e4f () const void removeCoordinatesFromSequence classbpp_1_1MafBlock.html aa2f659d1b13ee936e1d0934910ab8fc1 (size_t i) std::string getDescription classbpp_1_1MafBlock.html ab06518e567d9c3c067219a93b12d9d12 () const bool hasProperty classbpp_1_1MafBlock.html ab96271a832032f3c389e334b339a1891 (const std::string &property) const const Clonable & getProperty classbpp_1_1MafBlock.html a5503e3be030a789f0842a9dea4b9341f (const std::string &property) const void deleteProperty classbpp_1_1MafBlock.html ac79eb4dff19f8da3c4bc1b79d5edd268 (const std::string &property) void setProperty classbpp_1_1MafBlock.html adef4e3b6e8ba60f6ce60c7dfc87ec947 (const std::string &property, Clonable *data) void deleteProperties_ classbpp_1_1MafBlock.html a3a80859e3ee556ac4625a03cdcd5b051 () double score_ classbpp_1_1MafBlock.html a8933ca18eb8af3a147c3c5f400deb0d4 unsigned int pass_ classbpp_1_1MafBlock.html aadf280962ad263acc173d7c92140429a AlignedSequenceContainer alignment_ classbpp_1_1MafBlock.html ae35510d38dcf394363902d5bdbbba31e std::map< std::string, Clonable * > properties_ classbpp_1_1MafBlock.html a8e291b1a01e3111a22e563456434ebe1 bpp::MafIterator classbpp_1_1MafIterator.html virtual ~MafIterator classbpp_1_1MafIterator.html a4e861e99b1eb477c26048e720dee552a () virtual MafBlock * nextBlock classbpp_1_1MafIterator.html a655e98cf03ed6fbf8c0526c46d50d1b1 ()=0 virtual bool isVerbose classbpp_1_1MafIterator.html a1ae26b9b0917ad3d1af03c7afea40c95 () const =0 virtual void setVerbose classbpp_1_1MafIterator.html a5470b0384c03db196c128d5c8c742d37 (bool yn)=0 virtual void addIterationListener classbpp_1_1MafIterator.html a36a997ed134b35f1cddd2258d051cd13 (IterationListener *listener)=0 bpp::AbstractMafIterator classbpp_1_1AbstractMafIterator.html bpp::MafIterator AbstractMafIterator classbpp_1_1AbstractMafIterator.html ac1f940e0046a3b801cd4205236645fe8 () virtual ~AbstractMafIterator classbpp_1_1AbstractMafIterator.html a6957423e380a47d40452a800cbdccca0 () virtual MafBlock * analyseCurrentBlock_ classbpp_1_1AbstractMafIterator.html ae9f8b210df6b5c086b5a827b8c95361c ()=0 bpp::MafTrashIterator classbpp_1_1MafTrashIterator.html virtual ~MafTrashIterator classbpp_1_1MafTrashIterator.html a6143ab67178dda679bf0c118b3a2faa8 () virtual MafBlock * nextRemovedBlock classbpp_1_1MafTrashIterator.html a312bfc8541e3c549132d43b74609a21d ()=0 bpp::AbstractFilterMafIterator classbpp_1_1AbstractFilterMafIterator.html bpp::AbstractMafIterator AbstractFilterMafIterator classbpp_1_1AbstractFilterMafIterator.html a30ab31aa8f5511572193678ca82faec5 (MafIterator *iterator) AbstractFilterMafIterator classbpp_1_1AbstractFilterMafIterator.html a037244f472529ba57574e6f0ba988564 (const AbstractFilterMafIterator &it) AbstractFilterMafIterator & operator= classbpp_1_1AbstractFilterMafIterator.html adef511408306fcaa40295771e4399fa1 (const AbstractFilterMafIterator &it) bpp::TrashIteratorAdapter classbpp_1_1TrashIteratorAdapter.html bpp::AbstractMafIterator TrashIteratorAdapter classbpp_1_1TrashIteratorAdapter.html a6022e1cc88fa0fe4ef505b44c0d53254 (MafTrashIterator *iterator) TrashIteratorAdapter classbpp_1_1TrashIteratorAdapter.html a86aa2583396ab3af0da05b9a439cb25f (const TrashIteratorAdapter &iterator) TrashIteratorAdapter & operator= classbpp_1_1TrashIteratorAdapter.html a969d3a9a7ac94941d431f1c701714904 (const TrashIteratorAdapter &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1TrashIteratorAdapter.html a238166a135b31125d7070cb04da2b9df () MafTrashIterator * iterator_ classbpp_1_1TrashIteratorAdapter.html a8c1dcda5c92c2ea71e0102282ca659e2 bpp::MafIteratorSynchronizer classbpp_1_1MafIteratorSynchronizer.html bpp::AbstractFilterMafIterator MafIteratorSynchronizer classbpp_1_1MafIteratorSynchronizer.html ad54cee7992656809d580e5a4aee1a50d (MafIterator *primaryIterator, MafIterator *secondaryIterator) MafIteratorSynchronizer classbpp_1_1MafIteratorSynchronizer.html abe80193f0bf6d6494eca2be162438eb9 (const MafIteratorSynchronizer &iterator) MafIteratorSynchronizer & operator= classbpp_1_1MafIteratorSynchronizer.html a32cd3997cdd23956c0a0b82cf0b63eae (const MafIteratorSynchronizer &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1MafIteratorSynchronizer.html a4e8e7c63d9fbd4327b1b1e90a43f7c84 () MafIterator * secondaryIterator_ classbpp_1_1MafIteratorSynchronizer.html a282a9eb9aeba8d0a65d5dc1657750c8c bpp::MafParser classbpp_1_1MafParser.html bpp::AbstractMafIterator MafParser classbpp_1_1MafParser.html a14e9d405c9b4cef99e5d5ae9ab0777c6 (std::istream *stream, bool parseMask=false) MafParser classbpp_1_1MafParser.html a4f5198e6763fd193aa71f161c4715732 (const MafParser &maf) MafParser & operator= classbpp_1_1MafParser.html a3c9ed7904358f2296d39cfbe3afd3e6e (const MafParser &maf) MafBlock * analyseCurrentBlock_ classbpp_1_1MafParser.html ab01faa2e376ee8ae4ce141095c86985e () std::istream * stream_ classbpp_1_1MafParser.html a5cdd478a1d5007c6b3499b58b0967d87 bool mask_ classbpp_1_1MafParser.html a70e8849ebeba3078cd9a188b00fe0b32 CaseMaskedAlphabet cmAlphabet_ classbpp_1_1MafParser.html a93bc5f1150db05f89e78137b4fd44e12 bool firstBlock_ classbpp_1_1MafParser.html a3de366bc5cc5d3f1f4a74d5c1d189233 bpp::MafSequence classbpp_1_1MafSequence.html bpp::SequenceWithAnnotation MafSequence classbpp_1_1MafSequence.html a2ba0434d225d4f64ed9b8bbd682851e4 () MafSequence classbpp_1_1MafSequence.html a1caee031cd31f877d7f5b745c723c426 (const std::string &name, const std::string &sequence, bool parseName=true) MafSequence classbpp_1_1MafSequence.html a59e49f8ee1e33978321db694a68189e8 (const std::string &name, const std::string &sequence, size_t begin, char strand, size_t srcSize, bool parseName=true) MafSequence * clone classbpp_1_1MafSequence.html af062448b1f27f40d4e717a22e5f3da87 () const ~MafSequence classbpp_1_1MafSequence.html ab52fd743552fcc5792c0473240a7d19b () bool hasCoordinates classbpp_1_1MafSequence.html a80bace5e90262a758ccdb475312b20b8 () const void removeCoordinates classbpp_1_1MafSequence.html a62f6259d2f358c6bcf6f3896c49f6432 () size_t start classbpp_1_1MafSequence.html a19498c998794f0526ab9133b234b1289 () const size_t stop classbpp_1_1MafSequence.html a4e3165c4d25212c4b919ac85c7f935af () const Range< size_t > getRange classbpp_1_1MafSequence.html a42266313a1cdf574d408e09d0b292d42 (bool origin=true) const void setName classbpp_1_1MafSequence.html a134552d34605984e4cb566e9e992f17b (const std::string &name) const std::string & getSpecies classbpp_1_1MafSequence.html ac81b6bca2f3d2bfe0d12757b85ed3de0 () const const std::string & getChromosome classbpp_1_1MafSequence.html a9d58952d748526cd6731186ce07b3b4e () const char getStrand classbpp_1_1MafSequence.html ae211f326bef4d97074b1cc9e0e5235d9 () const size_t getGenomicSize classbpp_1_1MafSequence.html a4eec97ae3a93ab906b03053382b0bf05 () const size_t getSrcSize classbpp_1_1MafSequence.html a5740c6b3755d61f5fcac84151be9ae70 () const void setStart classbpp_1_1MafSequence.html a5a55341f0e99a0e057b1c9e5a16ac63d (size_t begin) void setChromosome classbpp_1_1MafSequence.html a0d1711e2be7ed45aeba81f34c2c2aa9f (const std::string &chr) void setSpecies classbpp_1_1MafSequence.html adebcf474b25fdeece5df589211a32cf9 (const std::string &species) void setStrand classbpp_1_1MafSequence.html a69a879878bd985aade72a9e06ed531de (char s) void setSrcSize classbpp_1_1MafSequence.html a4944a59662f180a39005e3552fe7b3f4 (size_t srcSize) std::string getDescription classbpp_1_1MafSequence.html a39a70085338246a6719f7874700107f6 () const MafSequence * subSequence classbpp_1_1MafSequence.html ab5a26a37180cffffe1758a15f6043bbc (size_t startAt, size_t length) const static void splitNameIntoSpeciesAndChromosome classbpp_1_1MafSequence.html a7fa51caf815a9fb4f3e1c4c6d8b4d90a (const std::string &name, std::string &species, std::string &chr) void beforeSequenceChanged classbpp_1_1MafSequence.html a6ccf166612181b5ca550caa04647b65b (const SymbolListEditionEvent &event) void afterSequenceChanged classbpp_1_1MafSequence.html abac31fbcc1564765a807ce18b4092ea9 (const SymbolListEditionEvent &event) void beforeSequenceInserted classbpp_1_1MafSequence.html aa98f498ab72626fa359bc2dbff5406af (const SymbolListInsertionEvent &event) void afterSequenceInserted classbpp_1_1MafSequence.html ab97eece6ed1fe3b9717ec32839ff9a5c (const SymbolListInsertionEvent &event) void beforeSequenceDeleted classbpp_1_1MafSequence.html a3bc3991435b56c4d04cf82f29079f8f3 (const SymbolListDeletionEvent &event) void afterSequenceDeleted classbpp_1_1MafSequence.html a74a3d87c7f29d34325f0368de340418e (const SymbolListDeletionEvent &event) void beforeSequenceSubstituted classbpp_1_1MafSequence.html a0aee40a3f4a537997c73eeca6adc14d6 (const SymbolListSubstitutionEvent &event) void afterSequenceSubstituted classbpp_1_1MafSequence.html aa47a8c5b148d40e42e4ad85a79c90a74 (const SymbolListSubstitutionEvent &event) bool hasCoordinates_ classbpp_1_1MafSequence.html a8ac4e06a988b4bdf2859a88fce0c8bc0 size_t begin_ classbpp_1_1MafSequence.html abecc9851c667fe43afd0cd50f2adad92 std::string species_ classbpp_1_1MafSequence.html a97d5ba2ab0e5add5b07ed7b73c2bff31 std::string chromosome_ classbpp_1_1MafSequence.html ab0980c4e3ba5454e6ea144ed833dd545 char strand_ classbpp_1_1MafSequence.html a98fa7d7ee81f35baa5574837e0cc79cf size_t size_ classbpp_1_1MafSequence.html a6225e191b95bef2c185b72e74f7170a0 size_t srcSize_ classbpp_1_1MafSequence.html abe458a4628372b53c02d88d0101dcf58 bpp::MafStatisticsResult classbpp_1_1MafStatisticsResult.html MafStatisticsResult classbpp_1_1MafStatisticsResult.html a805f685860d87004239d1043216e7f3b () virtual ~MafStatisticsResult classbpp_1_1MafStatisticsResult.html aa769e27c1683a4e2d1a1bac9719fd388 () MafStatisticsResult classbpp_1_1MafStatisticsResult.html a8015358f69a833b5855ed94f0f9f2cfa (const MafStatisticsResult &msr) virtual const BppNumberI & getValue classbpp_1_1MafStatisticsResult.html a9d73c0f9f40356044979b75976e8f329 (const std::string &tag) const virtual void setValue classbpp_1_1MafStatisticsResult.html a6f3e496acb5b85beb787b1b0a3855c0b (const std::string &tag, double value) virtual void setValue classbpp_1_1MafStatisticsResult.html a280f1dacced87ffa52850c0e17ee39e6 (const std::string &tag, int value) virtual void setValue classbpp_1_1MafStatisticsResult.html a0683ba6930bca690e060223034147c62 (const std::string &tag, unsigned int value) virtual bool hasValue classbpp_1_1MafStatisticsResult.html a5cc994fbd57f04423f8186b2905b54a9 (const std::string &tag) const std::vector< std::string > getAvailableTags classbpp_1_1MafStatisticsResult.html ab52a414a67f2bde835576d72773cae35 () const std::map< std::string, BppNumberI * > values_ classbpp_1_1MafStatisticsResult.html a284d7b348f475feb21e8acb48b769b2d bpp::SimpleMafStatisticsResult classbpp_1_1SimpleMafStatisticsResult.html bpp::MafStatisticsResult SimpleMafStatisticsResult classbpp_1_1SimpleMafStatisticsResult.html a0817f2410982bb0fd3a818c034990864 (const std::string &name) virtual ~SimpleMafStatisticsResult classbpp_1_1SimpleMafStatisticsResult.html a3c2faaf633b4d23c66e59d235728180a () virtual const BppNumberI & getValue classbpp_1_1SimpleMafStatisticsResult.html a39f7aff9f0c81ae4b39eff416632df1c (const std::string &tag) const virtual const BppNumberI & getValue classbpp_1_1SimpleMafStatisticsResult.html a60d3a4a8e4b5f33de60a9cfd93676d4e () const virtual void setValue classbpp_1_1SimpleMafStatisticsResult.html ab215d4c3889372bbca9f7a9608f59b18 (const std::string &tag, double value) virtual void setValue classbpp_1_1SimpleMafStatisticsResult.html af3ffa3f2695ee951bdfc445aef8f1b57 (const std::string &tag, int value) virtual void setValue classbpp_1_1SimpleMafStatisticsResult.html adc979ca660759d2ee0168d674414bd2e (const std::string &tag, unsigned int value) virtual void setValue classbpp_1_1SimpleMafStatisticsResult.html ab6944742ddefc104a419d5cceb22d400 (double value) virtual void setValue classbpp_1_1SimpleMafStatisticsResult.html a1ac5ceaaf988852af1698c0ce8d7a234 (int value) virtual void setValue classbpp_1_1SimpleMafStatisticsResult.html af23af5173245935a65cd74ac790346bc (unsigned int value) std::string name_ classbpp_1_1SimpleMafStatisticsResult.html ab170c8df5e71bfe063e51da4e9598b55 bpp::MafStatistics classbpp_1_1MafStatistics.html MafStatistics classbpp_1_1MafStatistics.html a6ee688c65912465d8357ba449d1132e1 () virtual ~MafStatistics classbpp_1_1MafStatistics.html a8bf9ce95a362180b7e0d004f8c29befd () virtual std::string getShortName classbpp_1_1MafStatistics.html af0c9f79bebf57fd0f91153b34befdc9f () const =0 virtual std::string getFullName classbpp_1_1MafStatistics.html aae4be18d0f1290cc1cf64008203fa4f4 () const =0 virtual const MafStatisticsResult & getResult classbpp_1_1MafStatistics.html a6f904d5de86215b4a28f481175c62866 () const =0 virtual void compute classbpp_1_1MafStatistics.html a3e7f72ee7b66dbb4e00699a14a920722 (const MafBlock &block)=0 virtual std::vector< std::string > getSupportedTags classbpp_1_1MafStatistics.html a7ed1335b56a21160333132b8295cd12e () const =0 bpp::AbstractMafStatistics classbpp_1_1AbstractMafStatistics.html bpp::MafStatistics AbstractMafStatistics classbpp_1_1AbstractMafStatistics.html a2989af09f09c425ffe6e0afa089b95a8 () virtual ~AbstractMafStatistics classbpp_1_1AbstractMafStatistics.html a433654f97397532eda746f55eba2d5f2 () const MafStatisticsResult & getResult classbpp_1_1AbstractMafStatistics.html af5de6f7ab3c8dcc676e1f9970e195422 () const MafStatisticsResult result_ classbpp_1_1AbstractMafStatistics.html ad6c6d3d9c777683d46ac932e1c948e99 bpp::AbstractMafStatisticsSimple classbpp_1_1AbstractMafStatisticsSimple.html bpp::MafStatistics AbstractMafStatisticsSimple classbpp_1_1AbstractMafStatisticsSimple.html adeea5a5f297b30c66b009b12960c21f2 (const std::string &name) virtual ~AbstractMafStatisticsSimple classbpp_1_1AbstractMafStatisticsSimple.html ab3b88820011d31ab120ee688e6b07cea () const SimpleMafStatisticsResult & getResult classbpp_1_1AbstractMafStatisticsSimple.html abbdc7e935065241c814f877c9f9bef62 () const std::vector< std::string > getSupportedTags classbpp_1_1AbstractMafStatisticsSimple.html ac08f7bd54f98824e8fb1a65af758d54b () const SimpleMafStatisticsResult result_ classbpp_1_1AbstractMafStatisticsSimple.html aec4c989c7f91ad60817ab36904f152e5 bpp::PairwiseDivergenceMafStatistics classbpp_1_1PairwiseDivergenceMafStatistics.html bpp::AbstractMafStatisticsSimple PairwiseDivergenceMafStatistics classbpp_1_1PairwiseDivergenceMafStatistics.html a9b409ca2ef98c8a21b44a6a57018b8d0 (const std::string &species1, const std::string &species2) ~PairwiseDivergenceMafStatistics classbpp_1_1PairwiseDivergenceMafStatistics.html a9f5f17c474032e4b2319839e0842212f () std::string getShortName classbpp_1_1PairwiseDivergenceMafStatistics.html a19da531e09a6c81e7d030c8baf6be02c () const std::string getFullName classbpp_1_1PairwiseDivergenceMafStatistics.html abbfb4114554df11ab5193985add95006 () const void compute classbpp_1_1PairwiseDivergenceMafStatistics.html a4911e16fa4c74d9fff5b42f8fbe0d1f3 (const MafBlock &block) std::string species1_ classbpp_1_1PairwiseDivergenceMafStatistics.html a36259284e5b72da0c6866e5be2724008 std::string species2_ classbpp_1_1PairwiseDivergenceMafStatistics.html a0d94ff07c725f591b9aa034c9055fd74 bpp::BlockSizeMafStatistics classbpp_1_1BlockSizeMafStatistics.html bpp::AbstractMafStatisticsSimple BlockSizeMafStatistics classbpp_1_1BlockSizeMafStatistics.html a98984dc9eaa0882c153bb632030b5fa8 () ~BlockSizeMafStatistics classbpp_1_1BlockSizeMafStatistics.html af055e6a8479171774697bc89d6a0974d () std::string getShortName classbpp_1_1BlockSizeMafStatistics.html a7c6645dab30ab4cc8cf919617e15b8f6 () const std::string getFullName classbpp_1_1BlockSizeMafStatistics.html ab429e8fac24e5d4a44d093b6bd29affa () const void compute classbpp_1_1BlockSizeMafStatistics.html a28327d23b91bbfbab52526d4d4483f26 (const MafBlock &block) bpp::BlockLengthMafStatistics classbpp_1_1BlockLengthMafStatistics.html bpp::AbstractMafStatisticsSimple BlockLengthMafStatistics classbpp_1_1BlockLengthMafStatistics.html a61594666cfcf0cacc5bcbc976386ac1b () ~BlockLengthMafStatistics classbpp_1_1BlockLengthMafStatistics.html a27d3b78706c46af271d83b91b909f433 () std::string getShortName classbpp_1_1BlockLengthMafStatistics.html a9e349ef1a653a710db8f7524be338374 () const std::string getFullName classbpp_1_1BlockLengthMafStatistics.html a5e6c6cb2d61e6c489fa9ec46796e9417 () const void compute classbpp_1_1BlockLengthMafStatistics.html a2a1cbef57a606d76672b595a9709c350 (const MafBlock &block) bpp::SequenceLengthMafStatistics classbpp_1_1SequenceLengthMafStatistics.html bpp::AbstractMafStatisticsSimple SequenceLengthMafStatistics classbpp_1_1SequenceLengthMafStatistics.html ae9dd7ebe1b0773b791ac075d4c417f87 (const std::string &species) ~SequenceLengthMafStatistics classbpp_1_1SequenceLengthMafStatistics.html afa546d1de2369f42c6ca782cb7c2fabe () std::string getShortName classbpp_1_1SequenceLengthMafStatistics.html ae890cd9995965263339d3cef8f0d92f3 () const std::string getFullName classbpp_1_1SequenceLengthMafStatistics.html a80880d69a082c945d53357a05461ebd8 () const void compute classbpp_1_1SequenceLengthMafStatistics.html ad4f9677fe2d634c5d5d21f86e6c24b4b (const MafBlock &block) std::string species_ classbpp_1_1SequenceLengthMafStatistics.html a92e9158724d3c3f3b90ff605f14489d0 bpp::AlignmentScoreMafStatistics classbpp_1_1AlignmentScoreMafStatistics.html bpp::AbstractMafStatisticsSimple AlignmentScoreMafStatistics classbpp_1_1AlignmentScoreMafStatistics.html a7e0114800a44066289f84040d733e9c5 () ~AlignmentScoreMafStatistics classbpp_1_1AlignmentScoreMafStatistics.html a3825a6c2800ebee7d20af3c0125606e1 () std::string getShortName classbpp_1_1AlignmentScoreMafStatistics.html acc694a314a88e421d87b4faea699629f () const std::string getFullName classbpp_1_1AlignmentScoreMafStatistics.html a84ec7c5e92aa978cc32bc79bcb65eddb () const void compute classbpp_1_1AlignmentScoreMafStatistics.html a99f0ed2e9f311ec15f7ac131418aceae (const MafBlock &block) bpp::CharacterCountsMafStatistics classbpp_1_1CharacterCountsMafStatistics.html bpp::AbstractMafStatistics CharacterCountsMafStatistics classbpp_1_1CharacterCountsMafStatistics.html a989027dc45de74d10760305d0fca8f78 (const Alphabet *alphabet) CharacterCountsMafStatistics classbpp_1_1CharacterCountsMafStatistics.html a99935a3c2b9155c733888aef6ca3a78d (const CharacterCountsMafStatistics &stats) CharacterCountsMafStatistics & operator= classbpp_1_1CharacterCountsMafStatistics.html ad19900ed72e16a366731b3b66128ac68 (const CharacterCountsMafStatistics &stats) virtual ~CharacterCountsMafStatistics classbpp_1_1CharacterCountsMafStatistics.html a2213025d386ea44aa30f8d06e3ea5136 () std::string getShortName classbpp_1_1CharacterCountsMafStatistics.html a28f9086cea1b5fee5f2085b7cbf353ba () const std::string getFullName classbpp_1_1CharacterCountsMafStatistics.html a71269b0be58723ce8a312984fa1f0310 () const void compute classbpp_1_1CharacterCountsMafStatistics.html a9eacbc17da8bebd53b083acd417098c1 (const MafBlock &block) std::vector< std::string > getSupportedTags classbpp_1_1CharacterCountsMafStatistics.html a42afdd3d406a7068bcd567058660592a () const const Alphabet * alphabet_ classbpp_1_1CharacterCountsMafStatistics.html aaab64d3758855fad252977b9b2e52f42 bpp::AbstractSpeciesSelectionMafStatistics classbpp_1_1AbstractSpeciesSelectionMafStatistics.html bpp::MafStatistics AbstractSpeciesSelectionMafStatistics classbpp_1_1AbstractSpeciesSelectionMafStatistics.html a6b2950fb90545c67ca73ecdaad92361a (const std::vector< std::string > &species) SiteContainer * getSiteContainer_ classbpp_1_1AbstractSpeciesSelectionMafStatistics.html a410fbce27d39d26d657791b0aa507684 (const MafBlock &block) std::vector< std::string > species_ classbpp_1_1AbstractSpeciesSelectionMafStatistics.html a5754e0c6c6b3adb6ebc40c995cdde14f bpp::AbstractSpeciesMultipleSelectionMafStatistics classbpp_1_1AbstractSpeciesMultipleSelectionMafStatistics.html bpp::MafStatistics AbstractSpeciesMultipleSelectionMafStatistics classbpp_1_1AbstractSpeciesMultipleSelectionMafStatistics.html a50f1bcbc70f5a72715925c3b2aeec5b6 (const std::vector< std::vector< std::string > > &species) std::vector< SiteContainer * > getSiteContainers_ classbpp_1_1AbstractSpeciesMultipleSelectionMafStatistics.html a1d36351d06e344fcffcab819f0ee9d51 (const MafBlock &block) std::vector< std::vector< std::string > > species_ classbpp_1_1AbstractSpeciesMultipleSelectionMafStatistics.html ad13dab583b6d27748dc92529d90cc428 bpp::SiteFrequencySpectrumMafStatistics classbpp_1_1SiteFrequencySpectrumMafStatistics.html bpp::AbstractMafStatistics bpp::AbstractSpeciesSelectionMafStatistics bpp::SiteFrequencySpectrumMafStatistics::Categorizer SiteFrequencySpectrumMafStatistics classbpp_1_1SiteFrequencySpectrumMafStatistics.html ae2f6a5d481665cb0adb373db889cd4a3 (const Alphabet *alphabet, const std::vector< double > &bounds, const std::vector< std::string > &ingroup, const std::string outgroup="") SiteFrequencySpectrumMafStatistics classbpp_1_1SiteFrequencySpectrumMafStatistics.html a7868688fb97ee98ab034f0c4d994e7cd (const SiteFrequencySpectrumMafStatistics &stats) SiteFrequencySpectrumMafStatistics & operator= classbpp_1_1SiteFrequencySpectrumMafStatistics.html a8be819556927dc75ee2d4100391cd50b (const SiteFrequencySpectrumMafStatistics &stats) virtual ~SiteFrequencySpectrumMafStatistics classbpp_1_1SiteFrequencySpectrumMafStatistics.html a395fcc489526a7d348b88bd98d3a399b () std::string getShortName classbpp_1_1SiteFrequencySpectrumMafStatistics.html aff9307c3bfc864042610b88a8fc8e135 () const std::string getFullName classbpp_1_1SiteFrequencySpectrumMafStatistics.html a726f8a04605842d2d9c2fecfab4294ed () const void compute classbpp_1_1SiteFrequencySpectrumMafStatistics.html aba6d33e7ff5d2387994b6bef7f5fcfc4 (const MafBlock &block) std::vector< std::string > getSupportedTags classbpp_1_1SiteFrequencySpectrumMafStatistics.html a6a0ad5c95edb09fc538c1cacac9310fe () const const Alphabet * alphabet_ classbpp_1_1SiteFrequencySpectrumMafStatistics.html a862096b71ae411bea636b2a155e6933f Categorizer categorizer_ classbpp_1_1SiteFrequencySpectrumMafStatistics.html ae2064f917123b646d08725fdfe911829 std::vector< unsigned int > counts_ classbpp_1_1SiteFrequencySpectrumMafStatistics.html a6cff6d060f7e491fc46c7d133ec7811c std::string outgroup_ classbpp_1_1SiteFrequencySpectrumMafStatistics.html ad98f4d9bc0ff476ad60231748e818f2f bpp::SiteFrequencySpectrumMafStatistics::Categorizer classbpp_1_1SiteFrequencySpectrumMafStatistics_1_1Categorizer.html Categorizer classbpp_1_1SiteFrequencySpectrumMafStatistics_1_1Categorizer.html a79f492607d44ba74cd2f37d16ceab47c (const std::vector< double > &bounds) size_t getNumberOfCategories classbpp_1_1SiteFrequencySpectrumMafStatistics_1_1Categorizer.html a462983200c5afee880b6075a665ce813 () const size_t getCategory classbpp_1_1SiteFrequencySpectrumMafStatistics_1_1Categorizer.html a0b0df73f3c771f5b46712eceb494bf97 (double value) const std::vector< double > bounds_ classbpp_1_1SiteFrequencySpectrumMafStatistics_1_1Categorizer.html adfc8c17bbdf6bc25956c59014bc2eb95 bpp::FourSpeciesPatternCountsMafStatistics classbpp_1_1FourSpeciesPatternCountsMafStatistics.html bpp::AbstractMafStatistics bpp::AbstractSpeciesSelectionMafStatistics FourSpeciesPatternCountsMafStatistics classbpp_1_1FourSpeciesPatternCountsMafStatistics.html af588c889373f541860852ad7d28671cf (const Alphabet *alphabet, const std::vector< std::string > &species) FourSpeciesPatternCountsMafStatistics classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a3bdf02ab07eed8ecb3c256a5a6a0aea5 (const FourSpeciesPatternCountsMafStatistics &stats) FourSpeciesPatternCountsMafStatistics & operator= classbpp_1_1FourSpeciesPatternCountsMafStatistics.html aa6ebe7e128a360917394df003bb56e0f (const FourSpeciesPatternCountsMafStatistics &stats) virtual ~FourSpeciesPatternCountsMafStatistics classbpp_1_1FourSpeciesPatternCountsMafStatistics.html af8df00cc22cb71f8f941166d664ff22b () std::string getShortName classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a47f4000e79a0ee731e63f772f8a58021 () const std::string getFullName classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a1ddfd9f81fb25d22c7ff82c2fc4cf818 () const void compute classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a7f8c85f64632bc5df5c619d213635e3e (const MafBlock &block) std::vector< std::string > getSupportedTags classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a76978fc1017836266b7bd3d33f9b416f () const const Alphabet * alphabet_ classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a368a43891bf3e7f2172001affe15f02d std::vector< unsigned int > counts_ classbpp_1_1FourSpeciesPatternCountsMafStatistics.html a04b305371745581290a21e9e64985c6f bpp::SiteMafStatistics classbpp_1_1SiteMafStatistics.html bpp::AbstractMafStatistics bpp::AbstractSpeciesSelectionMafStatistics SiteMafStatistics classbpp_1_1SiteMafStatistics.html acedc89e53d9f3ebf7450b4358c72e0fe (const std::vector< std::string > &species) virtual ~SiteMafStatistics classbpp_1_1SiteMafStatistics.html a62787802e4ffeaed951e594107334e6d () std::string getShortName classbpp_1_1SiteMafStatistics.html ae35c7512d74a25bb3c03e29579cc6d07 () const std::string getFullName classbpp_1_1SiteMafStatistics.html a2e7a8174bbe6c42d60e7b94ad1e73443 () const void compute classbpp_1_1SiteMafStatistics.html a2cf3ee198295e9620929d5a018916980 (const MafBlock &block) std::vector< std::string > getSupportedTags classbpp_1_1SiteMafStatistics.html a28c0fa65dc598cdc709fef83acdf62c3 () const bpp::PolymorphismMafStatistics classbpp_1_1PolymorphismMafStatistics.html bpp::AbstractMafStatistics bpp::AbstractSpeciesMultipleSelectionMafStatistics PolymorphismMafStatistics classbpp_1_1PolymorphismMafStatistics.html a0715353b2411ff8360eee838c6794fc1 (const std::vector< std::vector< std::string > > &species) virtual ~PolymorphismMafStatistics classbpp_1_1PolymorphismMafStatistics.html ac13e920337739b6529c70b186e605117 () std::string getShortName classbpp_1_1PolymorphismMafStatistics.html aeb6705645f2ee3cc7f8879c02af30455 () const std::string getFullName classbpp_1_1PolymorphismMafStatistics.html a5f2b811e967e556e17bb6a3f07a10a5c () const void compute classbpp_1_1PolymorphismMafStatistics.html ac4b05292c9cf0d870d9cac46b4a2e379 (const MafBlock &block) std::vector< std::string > getSupportedTags classbpp_1_1PolymorphismMafStatistics.html aa43cccd63f4cbac1cacb9eff96a19dee () const static std::vector< int > getPatterns_ classbpp_1_1PolymorphismMafStatistics.html a0081412ec742dcdb664f353d5a94f271 (const SiteContainer &sites) bpp::SequenceDiversityMafStatistics classbpp_1_1SequenceDiversityMafStatistics.html bpp::AbstractMafStatistics bpp::AbstractSpeciesSelectionMafStatistics SequenceDiversityMafStatistics classbpp_1_1SequenceDiversityMafStatistics.html a706b49e0dd3d8e1b2753b1683205db4c (const std::vector< std::string > &ingroup) virtual ~SequenceDiversityMafStatistics classbpp_1_1SequenceDiversityMafStatistics.html a4a0ab3ae3326eefa76be1ad616ce9fbb () std::string getShortName classbpp_1_1SequenceDiversityMafStatistics.html a3b6faa127b55a52b78e7e876410e879b () const std::string getFullName classbpp_1_1SequenceDiversityMafStatistics.html ae1bdd5b0b5fc7636a9169394b370496d () const void compute classbpp_1_1SequenceDiversityMafStatistics.html a32acab8424d39b1b43f42e230861a73f (const MafBlock &block) std::vector< std::string > getSupportedTags classbpp_1_1SequenceDiversityMafStatistics.html a59981424c10368d2e823fb56bfc30f8f () const static std::vector< int > getPatterns_ classbpp_1_1SequenceDiversityMafStatistics.html a168e8d369d98c84ec7f6ccd4a3a53489 (const SiteContainer &sites) bpp::MaskFilterMafIterator classbpp_1_1MaskFilterMafIterator.html bpp::AbstractFilterMafIterator bpp::MafTrashIterator MaskFilterMafIterator classbpp_1_1MaskFilterMafIterator.html ae9ea74d39fa0864177883cb437375a21 (MafIterator *iterator, const std::vector< std::string > &species, unsigned int windowSize, unsigned int step, unsigned int maxMasked, bool keepTrashedBlocks) MafBlock * nextRemovedBlock classbpp_1_1MaskFilterMafIterator.html a35db07285be7e18e929f7eed3b9b8763 () MafBlock * analyseCurrentBlock_ classbpp_1_1MaskFilterMafIterator.html a2ccf5d991f556384965c78da3d2190f0 () std::vector< std::string > species_ classbpp_1_1MaskFilterMafIterator.html a465cad4e30f65599a93c9afc4e42e5b0 unsigned int windowSize_ classbpp_1_1MaskFilterMafIterator.html a0b55e64e8353b3335d0a38b0533bf41b unsigned int step_ classbpp_1_1MaskFilterMafIterator.html a58f3b29e2b09b5b6ec586d5e14058d30 unsigned int maxMasked_ classbpp_1_1MaskFilterMafIterator.html aaa47ab33500a4e7044e1f5999d980bc0 std::deque< MafBlock * > blockBuffer_ classbpp_1_1MaskFilterMafIterator.html af265abfe85d8edc4c3d154dfe06dacee std::deque< MafBlock * > trashBuffer_ classbpp_1_1MaskFilterMafIterator.html ae6d30bc7fa4a89c00c569c2b4e2568b2 std::deque< std::vector< bool > > window_ classbpp_1_1MaskFilterMafIterator.html a9fa620b16952cbb2111b81ea9372474d bool keepTrashedBlocks_ classbpp_1_1MaskFilterMafIterator.html af2f659815eb1af061445667dc084cdf8 bpp::OrphanSequenceFilterMafIterator classbpp_1_1OrphanSequenceFilterMafIterator.html bpp::AbstractFilterMafIterator OrphanSequenceFilterMafIterator classbpp_1_1OrphanSequenceFilterMafIterator.html af81605f32561b6298fd9292f37b9192d (MafIterator *iterator, const std::vector< std::string > &species, bool strict=false, bool keep=false, bool rmDuplicates=false) OrphanSequenceFilterMafIterator classbpp_1_1OrphanSequenceFilterMafIterator.html aa3a6c7432b4c39d575e0e12e32076c70 (const OrphanSequenceFilterMafIterator &iterator) OrphanSequenceFilterMafIterator & operator= classbpp_1_1OrphanSequenceFilterMafIterator.html a8be37ba7ec4aa58fbe4dad24450041bc (const OrphanSequenceFilterMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1OrphanSequenceFilterMafIterator.html ae1e8dbdd4fc1a147acf1921e857b2f0e () std::vector< std::string > species_ classbpp_1_1OrphanSequenceFilterMafIterator.html a3c6c3a96d3d6ef6aa5fc7bdd7a93ac5a bool strict_ classbpp_1_1OrphanSequenceFilterMafIterator.html a02a1d63905ac98fd08d5b61e101d8b97 bool rmDuplicates_ classbpp_1_1OrphanSequenceFilterMafIterator.html a4b29c4085860b78ba02afeb391b0e33a bpp::OutputAlignmentMafIterator classbpp_1_1OutputAlignmentMafIterator.html bpp::AbstractFilterMafIterator OutputAlignmentMafIterator classbpp_1_1OutputAlignmentMafIterator.html ade9d96da1efd0cd88c505531d8089c10 (MafIterator *iterator, std::ostream *out, OAlignment *writer, bool mask=true) OutputAlignmentMafIterator classbpp_1_1OutputAlignmentMafIterator.html a9ec446d8698d108e881a0c4761d46098 (MafIterator *iterator, const std::string &file, OAlignment *writer, bool mask=true) ~OutputAlignmentMafIterator classbpp_1_1OutputAlignmentMafIterator.html ac0d53fd39b9216b5d5bae094bd5317a2 () OutputAlignmentMafIterator classbpp_1_1OutputAlignmentMafIterator.html ada902422b696a08ca824d408c41522b0 (const OutputAlignmentMafIterator &iterator) OutputAlignmentMafIterator & operator= classbpp_1_1OutputAlignmentMafIterator.html a80cb13ede91975efd13e291addec9676 (const OutputAlignmentMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1OutputAlignmentMafIterator.html ae4dd6c31134f41a598870716b3ed28e6 () void writeBlock classbpp_1_1OutputAlignmentMafIterator.html a4e2550764d675ba79863fe7db3da556d (std::ostream &out, const MafBlock &block) const std::ostream * output_ classbpp_1_1OutputAlignmentMafIterator.html ab54f102c042558af418dae1e3b46ef55 std::string file_ classbpp_1_1OutputAlignmentMafIterator.html ac5c7949aaaaea9b22262706de4ba9949 bool mask_ classbpp_1_1OutputAlignmentMafIterator.html a46e9b08feb8b2ff2ab7e14927380ada9 std::auto_ptr< OAlignment > writer_ classbpp_1_1OutputAlignmentMafIterator.html a4c5564c32d17ab6bab75eb960be767e7 unsigned int currentBlockIndex_ classbpp_1_1OutputAlignmentMafIterator.html ae1fdc4d109ac4c4708f57caad3b367b5 bpp::OutputMafIterator classbpp_1_1OutputMafIterator.html bpp::AbstractFilterMafIterator OutputMafIterator classbpp_1_1OutputMafIterator.html ad7baa9048cd0093c7c54b6f0faeb7852 (MafIterator *iterator, std::ostream *out, bool mask=true) MafBlock * analyseCurrentBlock_ classbpp_1_1OutputMafIterator.html a29a8161f1f06dffcc96140d5e8bc39a5 () OutputMafIterator classbpp_1_1OutputMafIterator.html a09e30feaf1e35b04fd439868655c8770 (const OutputMafIterator &iterator) OutputMafIterator & operator= classbpp_1_1OutputMafIterator.html a140bfeb5deaaf115900d5833732af6fc (const OutputMafIterator &iterator) void writeHeader classbpp_1_1OutputMafIterator.html a386358c7d154aa3f3ff03ecc75575393 (std::ostream &out) const void writeBlock classbpp_1_1OutputMafIterator.html a41052edbac527d4d9a4136284854faf8 (std::ostream &out, const MafBlock &block) const std::ostream * output_ classbpp_1_1OutputMafIterator.html a4fc6c52e833043c59cc88b00685b387a bool mask_ classbpp_1_1OutputMafIterator.html a2392e14907e954be8906d3ac3f5bc49b bpp::QualityFilterMafIterator classbpp_1_1QualityFilterMafIterator.html bpp::AbstractFilterMafIterator bpp::MafTrashIterator QualityFilterMafIterator classbpp_1_1QualityFilterMafIterator.html a4ede6daaa84260bb3d4071c967b1ba12 (MafIterator *iterator, const std::vector< std::string > &species, unsigned int windowSize, unsigned int step, unsigned int minQual, bool keepTrashedBlocks) MafBlock * nextRemovedBlock classbpp_1_1QualityFilterMafIterator.html a4b2ef33bca043d1f68435d83a83a44c4 () MafBlock * analyseCurrentBlock_ classbpp_1_1QualityFilterMafIterator.html a86142e2857bbbbb5a6090aa8a3c48361 () std::vector< std::string > species_ classbpp_1_1QualityFilterMafIterator.html aca1bb54e75e14af0b2af7d33384e3b7f unsigned int windowSize_ classbpp_1_1QualityFilterMafIterator.html ab82c912a9683233ad3445d9b1febe2ea unsigned int step_ classbpp_1_1QualityFilterMafIterator.html a8c843aa89a028efda9efcbedb7441b17 unsigned int minQual_ classbpp_1_1QualityFilterMafIterator.html a219e7fbe9717e03e5c897cf441e8be3f std::deque< MafBlock * > blockBuffer_ classbpp_1_1QualityFilterMafIterator.html a0c066ddaf6efa5f78bfc376afe3f76c7 std::deque< MafBlock * > trashBuffer_ classbpp_1_1QualityFilterMafIterator.html af991d92e273ffc5de4b33e97e7c9d30d std::deque< std::vector< int > > window_ classbpp_1_1QualityFilterMafIterator.html a08cadd9341074c57d846b1e42f7866d0 bool keepTrashedBlocks_ classbpp_1_1QualityFilterMafIterator.html ad626ff929808c729393db098edbc6a16 bpp::SequenceFilterMafIterator classbpp_1_1SequenceFilterMafIterator.html bpp::AbstractFilterMafIterator SequenceFilterMafIterator classbpp_1_1SequenceFilterMafIterator.html a31061f70dcb35e0ca7129bc3a8fa9a4f (MafIterator *iterator, const std::vector< std::string > &species, bool strict=false, bool keep=false, bool rmDuplicates=false) SequenceFilterMafIterator classbpp_1_1SequenceFilterMafIterator.html a6e8cc729bfe72c70c72804264f4ff2f5 (const SequenceFilterMafIterator &iterator) SequenceFilterMafIterator & operator= classbpp_1_1SequenceFilterMafIterator.html aee1dcf07a5a0c5b4eaf590d6135e635d (const SequenceFilterMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1SequenceFilterMafIterator.html aef2e0423cd47e9f43de36f732bb178c0 () std::vector< std::string > species_ classbpp_1_1SequenceFilterMafIterator.html a952887dc1136d2c9b8671a1f65af61b9 bool strict_ classbpp_1_1SequenceFilterMafIterator.html a2b33ed22c83bc43de86b684c2c6d8dd5 bool keep_ classbpp_1_1SequenceFilterMafIterator.html af9b38d614b8819e10d9db6fb04b4d05d bool rmDuplicates_ classbpp_1_1SequenceFilterMafIterator.html a7c2c4f0bdf67cb3f95d06be262694798 bpp::SequenceStatisticsMafIterator classbpp_1_1SequenceStatisticsMafIterator.html bpp::AbstractFilterMafIterator SequenceStatisticsMafIterator classbpp_1_1SequenceStatisticsMafIterator.html a53954c0f86bc35dd9bf7c9869a90fac4 (MafIterator *iterator, const std::vector< MafStatistics * > statistics) const std::vector< const BppNumberI * > & getResults classbpp_1_1SequenceStatisticsMafIterator.html a3ce2ca259d322a0f84ac77b53a82e407 () const const std::vector< std::string > & getResultsColumnNames classbpp_1_1SequenceStatisticsMafIterator.html a8573a0fc1804dd25fe686ec4d56adc80 () const SequenceStatisticsMafIterator classbpp_1_1SequenceStatisticsMafIterator.html abd2a41993f4a033a5434b8b843aa0acf (const SequenceStatisticsMafIterator &iterator) SequenceStatisticsMafIterator & operator= classbpp_1_1SequenceStatisticsMafIterator.html af80e24ca9cca84d6978b4c5b6747e5e8 (const SequenceStatisticsMafIterator &iterator) MafBlock * analyseCurrentBlock_ classbpp_1_1SequenceStatisticsMafIterator.html a7506bbfa915b5e273a2f9bf3502ea977 () std::vector< MafStatistics * > statistics_ classbpp_1_1SequenceStatisticsMafIterator.html a7fe9c1edfa60bcbc4d03087afbf22ff3 std::vector< const BppNumberI * > results_ classbpp_1_1SequenceStatisticsMafIterator.html a5db8097be9714eb7af4109cb21d3f8b5 std::vector< std::string > names_ classbpp_1_1SequenceStatisticsMafIterator.html a4fc17ff374085ce5928486b460e56ff5 bpp::SequenceStreamToMafIterator classbpp_1_1SequenceStreamToMafIterator.html bpp::AbstractMafIterator SequenceStreamToMafIterator classbpp_1_1SequenceStreamToMafIterator.html a1a52f740dc94617789e9ff17dd124e60 (ISequenceStream *seqStream, std::istream *stream, bool parseMask=false, bool zeroBasedCoordinates=true) SequenceStreamToMafIterator classbpp_1_1SequenceStreamToMafIterator.html a9495581e1e0a84330b3214e58f6ef8bd (const SequenceStreamToMafIterator &ss2mi) SequenceStreamToMafIterator & operator= classbpp_1_1SequenceStreamToMafIterator.html a554db75b572b164d8684ee8669523d93 (const SequenceStreamToMafIterator &ss2mi) MafBlock * analyseCurrentBlock_ classbpp_1_1SequenceStreamToMafIterator.html a4e10831e9b42695ed794b0928cd1411d () std::auto_ptr< ISequenceStream > seqStream_ classbpp_1_1SequenceStreamToMafIterator.html a2c365cabf84ca3da9fd1aee64b46db49 std::istream * stream_ classbpp_1_1SequenceStreamToMafIterator.html adf3f25e13e931afdbd8a9416c17de80e bool zeroBasedCoords_ classbpp_1_1SequenceStreamToMafIterator.html a624bcb1db40d508634ffef634779251e bool firstBlock_ classbpp_1_1SequenceStreamToMafIterator.html a4dd10e946752611cb85cd6165ab81d61 bpp::VcfOutputMafIterator classbpp_1_1VcfOutputMafIterator.html bpp::AbstractFilterMafIterator VcfOutputMafIterator classbpp_1_1VcfOutputMafIterator.html af4fbb43870cec2082f39346463d80cbd (MafIterator *iterator, std::ostream *out, const std::string &reference, const std::vector< std::string > &genotypes) MafBlock * analyseCurrentBlock_ classbpp_1_1VcfOutputMafIterator.html a7bc46212e1d96c515367e5906df62fed () VcfOutputMafIterator classbpp_1_1VcfOutputMafIterator.html a06cc4263053bc73bca35d10810bfbe91 (const VcfOutputMafIterator &iterator) VcfOutputMafIterator & operator= classbpp_1_1VcfOutputMafIterator.html ac7150c59ef5f2dde53f4e5ad89d3b72c (const VcfOutputMafIterator &iterator) void writeHeader_ classbpp_1_1VcfOutputMafIterator.html a81b02550b464146b29e24c6f7f1b190c (std::ostream &out) const void writeBlock_ classbpp_1_1VcfOutputMafIterator.html a383b10dcfa8a6d034524d9b657065739 (std::ostream &out, const MafBlock &block) const std::ostream * output_ classbpp_1_1VcfOutputMafIterator.html aa05f6925b69ea58f4fc432afd08f663d std::string refSpecies_ classbpp_1_1VcfOutputMafIterator.html a3dee55a754989f01de78b8630079f38c std::vector< std::string > genotypes_ classbpp_1_1VcfOutputMafIterator.html a5e6ebb8b65793ee00612894d0053eafc bpp::WindowSplitMafIterator classbpp_1_1WindowSplitMafIterator.html bpp::AbstractFilterMafIterator WindowSplitMafIterator classbpp_1_1WindowSplitMafIterator.html afc5e60a1d7973fa49b4592ed893cf7a1 (MafIterator *iterator, unsigned int windowSize, short splitOption=CENTER) static const short RAGGED_LEFT classbpp_1_1WindowSplitMafIterator.html aadf32c7cadc35cf897e1e616d8bf6293 static const short RAGGED_RIGHT classbpp_1_1WindowSplitMafIterator.html a36f7d803dee33e7ca62ec6806cc42d7c static const short CENTER classbpp_1_1WindowSplitMafIterator.html abaa9030317a26e79602cda1b3c9b7158 static const short ADJUST classbpp_1_1WindowSplitMafIterator.html afde73c4b7921122297c68255cb834685 MafBlock * analyseCurrentBlock_ classbpp_1_1WindowSplitMafIterator.html a4104f0be8542967dae925bf8211a09a1 () unsigned int windowSize_ classbpp_1_1WindowSplitMafIterator.html acdb4eeb394a9b8a847917d6e218824aa short align_ classbpp_1_1WindowSplitMafIterator.html abe2a229999ad0628101e5aa166ffb85c std::deque< MafBlock * > blockBuffer_ classbpp_1_1WindowSplitMafIterator.html a25780f326b31d0c7fbdd131202a1532d Bpp /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/ dir_b4185f083d1839e0639c310442fb68a8.html Bpp/Seq Bpp/Seq/Feature /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/ dir_8c8abb9f2ad7868a8e4632bd72c14c18.html Bpp/Seq/Feature/Gff Bpp/Seq/Feature/Gtf FeatureReader.h SequenceFeature.cpp SequenceFeature.h SequenceFeatureTools.cpp SequenceFeatureTools.h Bpp/Seq/Feature/Gff /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/Gff/ dir_c0bf08a5d2a47f401a6888f5e1d87c21.html GffFeatureReader.cpp GffFeatureReader.h Bpp/Seq/Feature/Gtf /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Feature/Gtf/ dir_09373788d42d67ba1bb1b5a4c9d36ae2.html GtfFeatureReader.cpp GtfFeatureReader.h Bpp/Seq/Io /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/ dir_5e67b57d7661860c73cf9ed56f8c6bb7.html Bpp/Seq/Io/Maf Fastq.cpp Fastq.h Bpp/Seq/Io/Maf /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/Io/Maf/ dir_5cd58ecbcb201e183133cbca86be7628.html AlignmentFilterMafIterator.cpp AlignmentFilterMafIterator.h BlockLengthMafIterator.h BlockMergerMafIterator.cpp BlockMergerMafIterator.h BlockSizeMafIterator.h ChromosomeMafIterator.cpp ChromosomeMafIterator.h ConcatenateMafIterator.cpp ConcatenateMafIterator.h CoordinatesOutputMafIterator.cpp CoordinatesOutputMafIterator.h DuplicateFilterMafIterator.cpp DuplicateFilterMafIterator.h EntropyFilterMafIterator.cpp EntropyFilterMafIterator.h FeatureExtractorMafIterator.cpp FeatureExtractorMafIterator.h FeatureFilterMafIterator.cpp FeatureFilterMafIterator.h FullGapFilterMafIterator.cpp FullGapFilterMafIterator.h IterationListener.cpp IterationListener.h MafBlock.h MafIterator.cpp MafIterator.h MafParser.cpp MafParser.h MafSequence.cpp MafSequence.h MafStatistics.cpp MafStatistics.h MaskFilterMafIterator.cpp MaskFilterMafIterator.h OrphanSequenceFilterMafIterator.cpp OrphanSequenceFilterMafIterator.h OutputAlignmentMafIterator.cpp OutputAlignmentMafIterator.h OutputMafIterator.cpp OutputMafIterator.h QualityFilterMafIterator.cpp QualityFilterMafIterator.h SequenceFilterMafIterator.cpp SequenceFilterMafIterator.h SequenceStatisticsMafIterator.cpp SequenceStatisticsMafIterator.h SequenceStreamToMafIterator.cpp SequenceStreamToMafIterator.h VcfOutputMafIterator.cpp VcfOutputMafIterator.h WindowSplitMafIterator.cpp WindowSplitMafIterator.h Bpp/Seq /home/jdutheil/Devel/Cpp/Projects/bpp-seq-omics/src/Bpp/Seq/ dir_a6df4600355513c0d02be2734b44b033.html Bpp/Seq/Feature Bpp/Seq/Io index index bpp-seq-omics-2.2.0/debian/rules000775 001750 001750 00000005405 12372454303 020167 0ustar00jdutheiljdutheil000000 000000 #!/usr/bin/make -f # -*- makefile -*- # Sample debian/rules that uses debhelper. # This file was originally written by Joey Hess and Craig Small. # As a special exception, when this file is copied by dh-make into a # dh-make output file, you may use that output file without restriction. # This special exception was added by Craig Small in version 0.37 of dh-make. # 24/01/10 Modification for use with CMake by Julien Dutheil. # Uncomment this to turn on verbose mode. #export DH_VERBOSE=1 # These are used for cross-compiling and for saving the configure script # from having to guess our platform (since we know it already) DEB_HOST_GNU_TYPE ?= $(shell dpkg-architecture -qDEB_HOST_GNU_TYPE) DEB_BUILD_GNU_TYPE ?= $(shell dpkg-architecture -qDEB_BUILD_GNU_TYPE) CFLAGS = -Wall -g ifneq (,$(findstring noopt,$(DEB_BUILD_OPTIONS))) CFLAGS += -O0 else CFLAGS += -O2 endif # shared library versions version=`ls src/lib*.so.* | \ awk '{if (match($$0,/[0-9]+\.[0-9]+\.[0-9]+$$/)) print substr($$0,RSTART)}'` major=`ls src/lib*.so.* | \ awk '{if (match($$0,/\.so\.[0-9]+$$/)) print substr($$0,RSTART+4)}'` configure: cmake -DCMAKE_INSTALL_PREFIX=/usr -DBUILD_TESTING=OFF . config.status: configure dh_testdir build: build-arch build-indep build-arch: build-stamp build-indep: build-stamp build-stamp: config.status dh_testdir # Add here commands to compile the package. $(MAKE) touch $@ clean: dh_testdir dh_testroot # Add here commands to clean up after the build process. [ ! -f Makefile ] || $(MAKE) clean; [ ! -f Makefile ] || rm Makefile; [ ! -f src/Makefile ] || rm src/Makefile; [ ! -f test/Makefile ] || rm test/Makefile; rm -f config.sub config.guess rm -f build-stamp rm -f CMakeCache.txt rm -f *.cmake rm -f src/*.cmake rm -f test/*.cmake rm -rf CMakeFiles rm -rf src/CMakeFiles rm -rf test/CMakeFiles rm -rf _CPack_Packages rm -rf Testing rm -f DartConfiguration.tcl dh_clean install: build dh_testdir dh_testroot dh_prep dh_installdirs # Add here commands to install the package into debian/tmp $(MAKE) DESTDIR=$(CURDIR)/debian/tmp install # Build architecture-independent files here. binary-indep: build install # We have nothing to do by default. # Build architecture-dependent files here. binary-arch: build install dh_testdir dh_testroot dh_installchangelogs ChangeLog dh_installdocs dh_installexamples dh_install # dh_installmenu # dh_installdebconf # dh_installlogrotate # dh_installemacsen # dh_installpam # dh_installmime # dh_installinit # dh_installcron # dh_installinfo dh_installman dh_link dh_strip dh_compress dh_fixperms # dh_perl # dh_python dh_makeshlibs dh_installdeb dh_shlibdeps dh_gencontrol dh_md5sums dh_builddeb binary: binary-indep binary-arch .PHONY: build clean binary-indep binary-arch binary install bpp-seq-omics-2.2.0/debian/libbpp-seq-omics1.install000664 001750 001750 00000000035 12372454303 023720 0ustar00jdutheiljdutheil000000 000000 debian/tmp/usr/lib/lib*.so.* bpp-seq-omics-2.2.0/debian/compat000664 001750 001750 00000000002 12372454303 020301 0ustar00jdutheiljdutheil000000 000000 5 bpp-seq-omics-2.2.0/debian/copyright000664 001750 001750 00000005641 12407765466 021062 0ustar00jdutheiljdutheil000000 000000 This package was debianized by Julien Dutheil on Wed, 22 Sep 2014 14:00:00 +0100. It was downloaded from Upstream Author: Julien Dutheil Copyright: Copyright (C) 2014 Bio++ Development Team License: This package is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. This package is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this package; if not, write to the Free Software Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA On Debian systems, the complete text of the GNU General Public License can be found in `/usr/share/common-licenses/GPL'. The Debian packaging is (C) 2014, Julien Dutheil and is licensed under the GPL, see above. The provided software is distributed under the CeCILL license: This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. The complete text of the license may be found here: http://www.cecill.info/licences/Licence_CeCILL_V2-en.html bpp-seq-omics-2.2.0/debian/libbpp-seq-omics-dev.install000664 001750 001750 00000000116 12372454303 024413 0ustar00jdutheiljdutheil000000 000000 debian/tmp/usr/include/* debian/tmp/usr/lib/lib*.a debian/tmp/usr/lib/lib*.so bpp-seq-omics-2.2.0/debian/source/format000664 001750 001750 00000000014 12372454303 021611 0ustar00jdutheiljdutheil000000 000000 3.0 (quilt) bpp-seq-omics-2.2.0/debian/changelog000664 001750 001750 00000001124 12407765466 020771 0ustar00jdutheiljdutheil000000 000000 libbpp-seq-omics (2.2.0-1) unstable; urgency=low * New statistics, including sequence diversity estimators * Several bugs and memory leaks fixed. -- Julien Dutheil Mon, 22 Sep 2014 14:00:00 +0100 libbpp-seq-omics (2.1.0-1) unstable; urgency=low * Maf to VCF tool added as a MafIterator. -- Julien Dutheil Wed, 06 Mar 2013 14:34:00 +0100 libbpp-seq-omics (2.0.3-1) unstable; urgency=low * Initial release, forking from bpp-seq. -- Julien Dutheil Tue, 06 Nov 2012 14:05:00 +0100 bpp-seq-omics-2.2.0/debian/postinst000775 001750 001750 00000002062 12372454303 020714 0ustar00jdutheiljdutheil000000 000000 #! /bin/bash # Abort if any command returns an error value set -e createGeneric() { echo "-- Creating generic include file: $1.all" #Make sure we run into subdirectories first: dirs=() for file in "$1"/* do if [ -d "$file" ] then # Recursion: dirs+=( "$file" ) fi done for dir in ${dirs[@]} do createGeneric $dir done #Now list all files, including newly created .all files: if [ -f $1.all ] then rm $1.all fi dir=`basename $1` for file in "$1"/* do if [ -f "$file" ] && ( [ "${file##*.}" == "h" ] || [ "${file##*.}" == "all" ] ) then file=`basename $file` echo "#include \"$dir/$file\"" >> $1.all fi done; } case "$1" in configure) # Actualize .all files createGeneric /usr/include/Bpp ;; abort-upgrade|abort-remove|abort-deconfigure) echo "$1" ;; *) echo "postinst called with unknown argument \`\$1'" >&2 exit 0 ;; esac # dh_installdeb will replace this with shell code automatically # generated by other debhelper scripts. #DEBHELPER# exit 0 bpp-seq-omics-2.2.0/debian/postrm000775 001750 001750 00000002171 12372454303 020356 0ustar00jdutheiljdutheil000000 000000 #! /bin/bash # Abort if any command returns an error value set -e createGeneric() { echo "-- Creating generic include file: $1.all" #Make sure we run into subdirectories first: dirs=() for file in "$1"/* do if [ -d "$file" ] then # Recursion: dirs+=( "$file" ) fi done for dir in ${dirs[@]} do createGeneric $dir done #Now list all files, including newly created .all files: if [ -f $1.all ] then rm $1.all fi dir=`basename $1` for file in "$1"/* do if [ -f "$file" ] && ( [ "${file##*.}" == "h" ] || [ "${file##*.}" == "all" ] ) then file=`basename $file` echo "#include \"$dir/$file\"" >> $1.all fi done; } case "$1" in remove) # Automatically added by dh_makeshlibs ldconfig # Actualize .all files createGeneric /usr/include/Bpp ;; purge|upgrade|failed-upgrade|abort-install|abort-upgrade|disappear) echo $1 ;; *) echo "postrm called with unknown argument \`\$1'" >&2 exit 0 ;; esac # dh_installdeb will replace this with shell code automatically # generated by other debhelper scripts. #DEBHELPER# exit 0 bpp-seq-omics-2.2.0/debian/control000664 001750 001750 00000001427 12407765466 020530 0ustar00jdutheiljdutheil000000 000000 Source: libbpp-seq-omics Section: libs Priority: optional Maintainer: Loic Dachary Uploaders: Julien Dutheil Build-Depends: debhelper (>= 5), cmake (>= 2.6), libbpp-seq-dev (>= 2.2.0) Standards-Version: 3.9.4 Package: libbpp-seq-omics-dev Section: libdevel Architecture: any Depends: libbpp-seq-omics1 (= ${binary:Version}), ${misc:Depends}, libbpp-seq-dev (>= 2.2.0) Description: Bio++ Sequence library: genomics components. Contains the Bio++ sequence classes dedicated to genomics. Package: libbpp-seq-omics1 Section: libs Architecture: any Depends: ${shlibs:Depends}, ${misc:Depends}, libbpp-seq9 (>= 2.2.0) Description: Bio++ Sequence library: genomics components. Contains the Bio++ sequence classes dedicated to genomics. bpp-seq-omics-2.2.0/debian/prerm000775 001750 001750 00000001217 12372454303 020157 0ustar00jdutheiljdutheil000000 000000 #! /bin/bash # Abort if any command returns an error value set -e removeGeneric() { if [ -f $1.all ] then echo "-- Remove generic include file: $1.all" rm $1.all fi for file in "$1"/* do if [ -d "$file" ] then # Recursion: removeGeneric $file fi done } case "$1" in remove|upgrade|deconfigure) # Actualize .all files removeGeneric /usr/include/Bpp ;; failed-upgrade) echo "$1" ;; *) echo "prerm called with unknown argument \`$1'" >&2 exit 1 ;; esac # dh_installdeb will replace this with shell code automatically # generated by other debhelper scripts. #DEBHELPER# exit 0 bpp-seq-omics-2.2.0/CMakeLists.txt000664 001750 001750 00000014640 12407765466 020444 0ustar00jdutheiljdutheil000000 000000 # CMake script for Bio++ Sequence-Omics library # Author: Sylvain Gaillard and Julien Dutheil # Created: 30/07/2012 # Global parameters CMAKE_MINIMUM_REQUIRED(VERSION 2.6) PROJECT(bpp-seq-omics CXX) IF(NOT CMAKE_BUILD_TYPE) SET(CMAKE_BUILD_TYPE RelWithDebInfo CACHE STRING "Choose the type of build, options are: None Debug Release RelWithDebInfo MinSizeRel." FORCE) ENDIF(NOT CMAKE_BUILD_TYPE) SET(CMAKE_CXX_FLAGS "-Wall -Weffc++ -Wshadow -Wconversion") IF(NOT NO_VIRTUAL_COV) SET(NO_VIRTUAL_COV FALSE CACHE BOOL "Disable covariant return type with virtual inheritance, for compilers that do not support it." FORCE) ENDIF(NOT NO_VIRTUAL_COV) IF(NO_VIRTUAL_COV) MESSAGE("-- Covariant return with virtual inheritance disabled.") SET(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -DNO_VIRTUAL_COV=1") ENDIF(NO_VIRTUAL_COV) IF(NOT NO_DEP_CHECK) SET(NO_DEP_CHECK FALSE CACHE BOOL "Disable dependencies check for building distribution only." FORCE) ENDIF(NOT NO_DEP_CHECK) IF(NO_DEP_CHECK) MESSAGE("-- Dependencies checking disabled. Only distribution can be built.") ELSE(NO_DEP_CHECK) # Libtool-like version number # CURRENT:REVISION:AGE => file.so.(C-A).A.R # current: The most recent interface number that this library implements. # revision: The implementation number of the current interface. # age: The difference between the newest and oldest interfaces that this # library implements. # In other words, the library implements all the interface numbers in the # range from number current - age to current. SET(BPPSEQOMICS_VERSION_CURRENT "1") SET(BPPSEQOMICS_VERSION_REVISION "0") SET(BPPSEQOMICS_VERSION_AGE "0") # Effective version number computation math(EXPR BPPSEQOMICS_VERSION_MAJOR "${BPPSEQOMICS_VERSION_CURRENT} - ${BPPSEQOMICS_VERSION_AGE}") SET(BPPSEQOMICS_VERSION_MINOR ${BPPSEQOMICS_VERSION_AGE}) SET(BPPSEQOMICS_VERSION_PATCH ${BPPSEQOMICS_VERSION_REVISION}) SET(BPPSEQOMICS_VERSION "${BPPSEQOMICS_VERSION_MAJOR}.${BPPSEQOMICS_VERSION_MINOR}.${BPPSEQOMICS_VERSION_PATCH}") # Set the CMAKE_PREFIX_PATH for the find_library fonction when using non # standard install location IF(CMAKE_INSTALL_PREFIX) SET(CMAKE_PREFIX_PATH "${CMAKE_INSTALL_PREFIX}" ${CMAKE_PREFIX_PATH}) ENDIF(CMAKE_INSTALL_PREFIX) MACRO(IMPROVED_FIND_LIBRARY OUTPUT_LIBS lib_name include_to_find) #start: FIND_PATH(${lib_name}_INCLUDE_DIR ${include_to_find} ) SET(${lib_name}_NAMES ${lib_name} ${lib_name}lib ${lib_name}dll) FIND_LIBRARY(${lib_name}_LIBRARY NAMES ${${lib_name}_NAMES} PATH_SUFFIXES lib${LIB_SUFFIX}) IF(${lib_name}_LIBRARY) MESSAGE("-- Library ${lib_name} found here:") MESSAGE(" includes : ${${lib_name}_INCLUDE_DIR}") MESSAGE(" libraries: ${${lib_name}_LIBRARY}") ELSE(${lib_name}_LIBRARY) MESSAGE(FATAL_ERROR "${lib_name} required but not found.") ENDIF(${lib_name}_LIBRARY) #add the dependency: INCLUDE_DIRECTORIES(${${lib_name}_INCLUDE_DIR}) SET(${OUTPUT_LIBS} ${${OUTPUT_LIBS}} ${${lib_name}_LIBRARY}) ENDMACRO(IMPROVED_FIND_LIBRARY) #Find the Bio++ libraries: IMPROVED_FIND_LIBRARY(LIBS bpp-core Bpp/Clonable.h) IMPROVED_FIND_LIBRARY(LIBS bpp-seq Bpp/Seq/Alphabet/Alphabet.h) # Subdirectories ADD_SUBDIRECTORY(src) # Doxygen FIND_PACKAGE(Doxygen) IF (DOXYGEN_FOUND) ADD_CUSTOM_TARGET (apidoc cp Doxyfile ${CMAKE_BINARY_DIR}/Doxyfile-build COMMAND echo "OUTPUT_DIRECTORY=${CMAKE_BINARY_DIR}" >> ${CMAKE_BINARY_DIR}/Doxyfile-build COMMAND ${DOXYGEN_EXECUTABLE} ${CMAKE_BINARY_DIR}/Doxyfile-build WORKING_DIRECTORY ${CMAKE_SOURCE_DIR}) ADD_CUSTOM_TARGET (apidoc-stable cp Doxyfile ${CMAKE_BINARY_DIR}/Doxyfile-stable COMMAND echo "OUTPUT_DIRECTORY=${CMAKE_BINARY_DIR}" >> ${CMAKE_BINARY_DIR}/Doxyfile-stable COMMAND echo "HTML_HEADER=header.html" >> ${CMAKE_BINARY_DIR}/Doxyfile-stable COMMAND ${DOXYGEN_EXECUTABLE} ${CMAKE_BINARY_DIR}/Doxyfile-stable WORKING_DIRECTORY ${CMAKE_SOURCE_DIR}) ENDIF (DOXYGEN_FOUND) ENDIF(NO_DEP_CHECK) # Packager SET(CPACK_PACKAGE_NAME "libbpp-seq-omics") SET(CPACK_PACKAGE_VENDOR "Bio++ Development Team") SET(CPACK_PACKAGE_VERSION "2.2.0") SET(CPACK_PACKAGE_VERSION_MAJOR "2") SET(CPACK_PACKAGE_VERSION_MINOR "2") SET(CPACK_PACKAGE_VERSION_PATCH "0") SET(CPACK_PACKAGE_DESCRIPTION_SUMMARY "The Bio++ Sequence-Omics library") SET(CPACK_RESOURCE_FILE_LICENSE "${CMAKE_SOURCE_DIR}/COPYING.txt") SET(CPACK_RESOURCE_FILE_AUTHORS "${CMAKE_SOURCE_DIR}/AUTHORS.txt") SET(CPACK_RESOURCE_FILE_INSTALL "${CMAKE_SOURCE_DIR}/INSTALL.txt") SET(CPACK_SOURCE_GENERATOR "TGZ") SET(CPACK_SOURCE_IGNORE_FILES "CMakeFiles" "Makefile" "_CPack_Packages" "CMakeCache.txt" ".*\\\\.cmake" ".*\\\\.git" ".*\\\\.gz" ".*\\\\.deb" ".*\\\\.rpm" ".*\\\\.dmg" ".*\\\\..*\\\\.swp" "src/\\\\..*" "src/libbpp*" "debian/tmp" "debian/libbpp.*/" "debian/libbpp.*\\\\.so.*" "debian/libbpp.*\\\\.a" "debian/libbpp.*\\\\.substvars" "debian/libbpp.*\\\\.debhelper" "debian/debhelper\\\\.log" "html" "Seq.tag" "Testing" "build-stamp" "install_manifest.txt" "DartConfiguration.tcl" ${CPACK_SOURCE_IGNORE_FILES} ) IF (MACOS) SET(CPACK_GENERATOR "Bundle") ENDIF() SET(CPACK_SOURCE_PACKAGE_FILE_NAME "${CMAKE_PROJECT_NAME}-${CPACK_PACKAGE_VERSION_MAJOR}.${CPACK_PACKAGE_VERSION_MINOR}.${CPACK_PACKAGE_VERSION_PATCH}") SET(CPACK_DEBSOURCE_PACKAGE_FILE_NAME "lib${CMAKE_PROJECT_NAME}_${CPACK_PACKAGE_VERSION_MAJOR}.${CPACK_PACKAGE_VERSION_MINOR}.${CPACK_PACKAGE_VERSION_PATCH}.orig") INCLUDE(CPack) #This adds the 'dist' target ADD_CUSTOM_TARGET(dist COMMAND ${CMAKE_MAKE_PROGRAM} package_source) # 'clean' is not (yet) a first class target. However, we need to clean the directories before building the sources: IF("${CMAKE_GENERATOR}" MATCHES "Make") ADD_CUSTOM_TARGET(make_clean COMMAND ${CMAKE_MAKE_PROGRAM} clean WORKING_DIRECTORY ${CMAKE_CURRENT_DIR} ) ADD_DEPENDENCIES(dist make_clean) ENDIF() IF(NOT NO_DEP_CHECK) IF (UNIX) #This creates deb packages: ADD_CUSTOM_TARGET(origdist COMMAND cp ${CPACK_SOURCE_PACKAGE_FILE_NAME}.tar.gz ../${CPACK_DEBSOURCE_PACKAGE_FILE_NAME}.tar.gz) ADD_DEPENDENCIES(origdist dist) ADD_CUSTOM_TARGET(deb dpkg-buildpackage -uc -us -i${CPACK_SOURCE_PACKAGE_FILE_NAME}.tar.gz) ADD_DEPENDENCIES(deb origdist) #This creates rpm packages: ADD_CUSTOM_TARGET(rpm rpmbuild -ta ${CPACK_SOURCE_PACKAGE_FILE_NAME}.tar.gz) ADD_DEPENDENCIES(rpm dist) ENDIF() SET(CTEST_UPDATE_TYPE git) SET(UPDATE_COMMAND "git") SET(UPDATE_OPTIONS "") ENABLE_TESTING() INCLUDE(CTest) IF (BUILD_TESTING) ADD_SUBDIRECTORY(test) ENDIF(BUILD_TESTING) ENDIF(NOT NO_DEP_CHECK) bpp-seq-omics-2.2.0/ChangeLog000664 001750 001750 00000032521 12407765466 017454 0ustar00jdutheiljdutheil000000 000000 22/09/14 -*- Version 2.2.0 -*- 22/08/13 Julien Dutheil * Sequence diversity estimators (Watterson theta) 12/08/13 Julien Dutheil * New Four species statistics 06/03/13 -*- Version 2.1.0 -*- 05/02/13 Julien Dutheil * Added VCF export 21/01/13 Julien Dutheil * Compiles with -Wconversion 31/10/12 Julien Dutheil * Added SequenceStreamToMafIterator 30/07/12 Julien Dutheil * Migrated files from bpp-seq to bpp-seq-omics. *** bpp-seq log copied here for information *** 18/07/12 Julien Dutheil * Bug fixed in merge maf iterator, in case a sequence is missing in one of the two blocks. 25/06/12 Julien Dutheil * Extended maf tools and reorganization of the code. * Extended GFF output. * New [] operator in SequenceFeatureSet. 18/06/12 Julien Dutheil * Fixed bug in Maf parser: scores are now parsed correctly. 08/03/12 Julien Dutheil * Added support for '*' character in proteins (stop codon) 09/02/12 -*- Version 2.0.3 -*- 16/01/12 Julien Dutheil * Bug #42 solved, new support for extended fasta parser in application tools. * Added contribution from Benoit Nabholz and Annabelle Haudry on 4-fold degenerated sites. 06/01/12 Julien Dutheil * Added support for "!" state in nucleic alphabet, which can be either a gap or an unknown character. 24/11/11 Julien Dutheil * Added SequenceWalker class and test. 22/11/11 Sylvain Gaillard * Added support for FastQ 21/11/11 Julien Dutheil * Added support for GFF3. 21/11/11 Sylvain Gaillard * Bug #35 solved. 18/11/11 Julien Dutheil * New MafIterators: SequenceStatistics and PairwiseSequenceStatistics. * Function SequenceTools::getPercentIdentity now allows to exclude gaps. 15/09/11 Julien Dutheil * Merge function of SequenceWithAnnotation now also merges annotations properly. 17/06/11 Julien Dutheil * Bug #39 solved. 09/06/11 -*- Version 2.0.2 -*- 08/06/11 Julien Dutheil * Fixed several Maf iterators. 28/02/11 -*- Version 2.0.1 -*- * Fixed debian packaging. 07/02/11 -*- Version 2.0.0 -*- 19/11/10 Julien Dutheil * Solved bug 0000016 (General comments not copied in containers). * A few more code cleaning. 01/11/10 Julien Dutheil * Solved bug 0000005 (Clustal parser). * Added unit testing for sequence input format. * Solved bug 0000004 (Remove gap sites in SiteContainer). 12/10/10 Benoît Nabholz * Added yeast mitochondrial codon alphabet and genetic code. 20/09/10 Julien Dutheil * Reorganization of the code for version 2.0. 06/09/10 Julien Dutheil * Added support for masked sequences in SequenceWithAnnotationTools and MafParser. 05/09/10 Julien Dutheil * First draft of CaseMaskedAlphabet, for dealing with repeat-masked sequences for instance. 21/07/10 Julien Dutheil * Added method hasSequence(name) in SequenceContainer interface. 20/07/10 Julien Dutheil * New Sequence interface design. * Maf parser now reads quality scores if there are some. 19/07/10 Julien Dutheil * New method isInit in CodonAlphabet. * New method getCDS in SequenceTools. 28/04/10 Julien Dutheil * New MAF genome alignment parser. 22/04/10 Sylvain Gaillard * Break SequenceTools interface: - renamed invert -> getInvert - renamed complement -> getComplement now invert and complement methods deals with sequence ref - New method invertComplement 16/04/10 Julien Dutheil * New Stockholm sequence format (output only). * Refactoring of class ISequence2 => IAlignment + new interface OAlignment. 24/03/10 -*- Version 1.7.0 -*- 11/03/10 Julien Dutheil * Nexus format now deals with lower case keywords. 17/12/09 Julien Dutheil * Code cleaning for VectorSiteContainer * New class CompressedVectorSiteContainer using less memory than VectorSiteContainer, but more restricted. 16/11/09 Sylvain Gaillard * No more "using namespace" in header files. 04/11/09 Julien Dutheil * Remove SymbolListTools::randomizeContent to a more efficient SymbolList::shuffle method. 12/10/09 Julien Dutheil * Now SeqLib compiles with -Weffc++ and -Wshadow without any warning :) 22/09/09 Julien Dutheil * Finally added 'addSequence' method in SequenceContainer. * MapSequenceContainer now has a addSequence method that uses the name of the sequence as a key by default. * Several methods in Sequence/SiteContainerTools are not templated anymore and have been improved. 09/09/09 Sylvain Gaillard * Fixed white space skip in Fasta sequence 20/08/09 Julien Dutheil * Added config files for CMake. 19/08/09 Sylvain Gaillard * Introduced 3 new interfaces IOSequenceStream, ISequenceStream and OSequenceStream. These interfaces are intended to be used by IOFormat dealing with Sequence and not SequenceContainers. They are actually implemented by the Fasta class. 17/08/09 Adam Smith * Bug fixed in DefaultAlphabet: unknow state is 37 not 38. 04/08/09 Sylvain Gaillard * Introduced new classes for Alphabet States 23/07/09 Sylvain Gaillard * Added SequenceTools::getPutativeHaplotypes 22/07/09 Sylvain Gaillard * Added SequenceTools::getNumberOfUnresolvedSites * Updated SequenceTools::getNumberOfSites, SequenceTools::getNumberOfCompleteSites and SequenceTools::removeGaps to be Alphabet implementation independant. 07/07/07 Julien Dutheil * Updated GranthamAAChemicalDistance, with a new signed, non-symmetric, option. 26/06/09 Sylvain Gaillard * Added new SequencePositionIterators classes. 23/06/09 Julien Dutheil * Actualization of the Container classes: now returns references and not pointer. Several code updates, including copy contructors. 17/06/09 Sylvain Gaillard (Glasgow Workshop) * Fix DNA/RNA/ProteicAlphabet::getAlias: works now with lower case states. * Fix SiteTools::isConstant test gap or unknown * Turning SequenceContainerTools::getFrequencies into void function. 21/07/08 -*- Version 1.6.0 -*- 28/05/09 Julien Dutheil * Added basic support for the Nexus format. 22/05/09 Julien Dutheil * Improved Clustal format (solves bug found by Emmanuel M.) * SequenceApplicationTools uses the keyval syntax for format description. 27/04/09 Julien Dutheil * Added site randomization method. 28/02/09 Julien Dutheil * Added mutual information calculation. * Added pairwise counting methods. * Frequencies counting methods have been improved (avoid useless copy of maps). 16/01/09 Julien Dutheil * max_gap_allowed option in SequenceApplicationTools is now a included bound: 0 or 0% will keep all complete sites, and 'n=number of sequences' or 100% will keep all sites. 13/01/09 Sylvain Gaillard * Little optimization in Fasta::write() method. 12/01/09 Sylvain Gaillard * Added support for comments (HUPO-PSI like) in Fasta. 08/01/09 Julien Dutheil * SequenceTools::reverse method has been deprecated in favor of the SequenceTools::inverse method, of witch it is now an alias. 07/01/09 Julien Dutheil * Code improvement in Vector containers. 21/12/08 Julien Dutheil * Return type for clone() methods corrected (Sequence, Site, SiteContainer and derivated classes). * Bug fixed in SequenceApplicationTools::get[Sequence/Site]Container, phylip format. 21/07/08 -*- Version 1.5.0 -*- 05/12/08 Julien Dutheil * VectorSiteContainer::getSite() faster (more than 10 times faster on a ~500 sequences data set!) 04/12/08 Julien Dutheil * Fixed missing redefinition of translate and reverse methods in class DNAToRNA. * Made inheritance virtual. 01/12/08 Julien Dutheil * New methods getSupportedInts and getSupportedChars in Alphabet classes. 18/11/08 Julien Dutheil * biopp-help-forum 91 (by Stephen Smith): Fasta, Mase, Clustal and Phylip now have an option to turn off the name checking and decrease loading time. * biopp-help-forum 93 (by Stephen Smith): Phylip format now supports any delimiter when reading/writing files in extended format. 14/11/08 Sylvain Gaillard * New method SequenceTools::subtractHaplotype(Sequence, Sequence, string, unsigned int). 07/11/08 Julien Dutheil * New contructor in VectorSiteContainer now as a tag to disable position checking, which can turn to be quite slow. 06/11/08 Sylvain Gaillard * New class PhredPhd to read sequence from phd files produced by the phred program * Removed an unused method in PhredPoly 05/11/08 Sylvain Gaillard * New methods Alphabet::getGeneric(states) implemented in AbstractAlphabet, DefaultAlphabet, DNA, RNA and ProteicAlphabet. * New alphabet exception CharStateNotSupportedException. * New class PhredPoly to read sequence from poly files produced by the phred program. * Fixed heterozygous site read in PhredPoly. 09/10/08 Julien Dutheil * New method SequenceTools::invert(Sequence). 24/09/08 Bastien Boussau & Julien Dutheil * Memory leak fixed in Fasta and Mase readers. 21/07/08 -*- Version 1.4.1 -*- 26/06/08 Julien Dutheil * Bug fixed in Clustal format. 20/04/08 Julien Dutheil * New interface ISequence2 for reading alignments. 18/03/08 Julien Dutheil and Bastien Boussau * Bowker's test for homogeneity implemented in SequenceTools. 08/02/08 Julien Dutheil * Bug fixed in VectorSequenceContainer: method addSequence is now virtual! (thanks to Laurent Gueguen for pointing out this bug)!. 07/02/08 Julien Dutheil * Added function isDNAAlphabet and isRNAAlphabet in AlphabetTools. * Bug fixed in getAlphabetFromSequence method. * Method getContent in Sequence and Site now outputs a reference. 18/01/08 -*- Version 1.4.0 -*- 09/01/08 Julien Dutheil * All classes included in the new 'bpp' namespace. 06/11/07 Julien Dutheil * New function SequenceContainerTools::merge. 02/10/07 Julien Dutheil * New class GenBank, enabling GenBank sequence format support for input. * Added new copy constructors from SequenceContainer in Vector[Site/Sequence]Container. * New methods changeUnresolvedCharacterToGaps and changeGapsToUnknownCharacters in SymbolListTools. * Bug fixed in changeUnresolvedCharacterToGaps in SiteContainerTools. 06/07/07 -*- Version 1.3.0 -*- 12/06/07 Julien Dutheil * More tools in class alphabet (isGap, isUnresolved, etc.) * New class DistanceMatrix, previously in phyllib. * New similarity measures in SiteContainerTools. 04/06/07 Julien Dutheil * New constructor from sequence names in VectorSiteContainer. 01/06/07 Julien Dutheil * New method SiteContainerTools::boostrapSites to bootstrap an alignment. 21/05/07 Julien Dutheil * New method SequenceContainerTools::getSequenceContainer to read non-aligned sequences. 04/05/07 Julien Dutheil * Bug fixed in global alignment with gap opening and extending penalties. * New generic score scheme. * Compatibility update (NumCalc) 24/04/07 Benoît Nabholz & Julien Dutheil * GeneticCode classes can now translate unknow codons to unknown amino acids. 02/04/07 Julien Dutheil * VIRTUAL_COV variable changed to NO_VIRTUAL_COV. configure.ac file updated. => Default behaviour is now /really/ to use covariant return type with virtual inheritence, even when importing the files in an IDE. To use the old compilers behaviour, one must set the NO_VIRTUAL_COV preproc variable. * this modification also solves a problem with the old configure.ac which was not correctly updated in version 1.2.0 :( * Bug fixed in SymbolListTools::getCounts. 02/04/07 Julien Dutheil * New method getAlphabetIndex1() in class SimpleIndexDistance. 24/02/07 Julien Dutheil * New pairwise alignment algorithm: gap opening and extending penalties. 22/02/07 Julien Dutheil * GeneticCode derivated classes now properly redefine the translate(Sequence&) method. 19/01/07 -*- Version 1.2.0 -*- 19/01/07 Julien Dutheil * Functions AlphabetTools::getType() and StringSequenceTools::getAlphabetFromSequence() rewritten. * New DefaultNucleotideScore matrix. * New AAIndex1Entry and AAIndex2Entry classes which create AlphabetIndex1 and AlphabetIndex2 objects from AAIndex1 and AAIndex2 entries, respectively. 18/12/06 Julien Dutheil * New alignment tools in SiteContainerTools, including the Needleman and Wunsch alogrithm. * BLOSUM50 matrix available. * Bug fixed in Sequence.h: method setContent is now properly redefined. * Bug fixed in ProteicAlphabet->getAbbr(int). The returned result is now correct!!! 06/12/06 Julien Dutheil * DefaultAlphabet now accepts "." characters. * New AlphabetTools::isDefaultAlphabet(const Alphabet *) method. * New SiteContainerTools::resolveDottedAlignment(const Sitecontainer &, const Alphabet *) method. 30/08/06 Julien Dutheil * Bug fixed in phylip sequential reader, + duplicated sequence in container now throws sequence name. (included in 1.1.1 release). 28/08/06 -*- Version 1.1.1 -*- 08/08/06 Julien Dutheil * Bug fixed in Phylip sequential read method. 15/06/06 Julien Dutheil * Method changeGapsToUnknownCharacters() moved from SequenceContainerTools to SiteContainerTools, and is really faster! * New removeGapOnlySites() method in SiteContainerTools. * New method SiteTools::isGapOnly(). * new 'sequence.max_gap_allowed' option in SequenceApplicationTools::getSitesToAnalyse(). 13/06/06 Julien Dutheil * Phylip sequential format improved, no more empty line between sequences needed. 12/06/06 Julien Dutheil * SiteTools::isConstant() method now has a 'ignoreUnknown' option. 01/01/06 Julien Dutheil * VectorSiteContainer and AlignedSequenceContainer now number sites from 1 (and not 0). 17/05/06 Benoît Nabholz, Sylvain Glémin & Julien Dutheil * Bug fixed in SiteContainerTools::getConsensus(), + SymbolListTools::getFrequencies() and getCounts() improved. 15/05/06 Julien Dutheil * Bug fixed: Added getUnknownCharacterCode() method in DefaultAlphabet. 09/05/06 Julien Dutheil * New AAChargeIndex class. * Bug fixed in SiteTools::hasUnknown(Site). 18/04/06 -*- Version 1.1.0 -*- 18/04/06 Julien Dutheil * New IOSequenceFactory class. 06/04/06 Julien Dutheil * New () function operators defined on SequenceContainers. bpp-seq-omics-2.2.0/AUTHORS.txt000664 001750 001750 00000001153 12372454303 017547 0ustar00jdutheiljdutheil000000 000000 Julien Dutheil Sylvain Gaillard Vincent Cahais Contributed code to Bio++ was enabled thanks to the following institutions and resources: 2007 - 2010 Bioinformatics Research Center, University of Aarhus (Julien Dutheil). Funded by European research Area on Plant Genomics (ERA-PG) ARelatives. 2010 - ISE-M UMR CNRS 5554 Université Montpellier 2 (Julien Dutheil) 2010 - ISE-M UMR CNRS 5554 Université Montpellier 2 (Vincent Cahais) 2007 - Genetics and Horticulture UMR INRA 1259 Angers-Nantes INRA Center (Sylvain Gaillard) bpp-seq-omics-2.2.0/test/test_gff.cpp000664 001750 001750 00000004413 12372454303 021147 0ustar00jdutheiljdutheil000000 000000 // // File: test_gff.cpp // Created by: Julien Dutheil // Created on: Mon Nov 21 14:31 2011 // /* Copyright or © or Copr. Bio++ Development Team, (November 17, 2004) This software is a computer program whose purpose is to provide classes for numerical calculus. This file is part of the Bio++ project. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include #include #include using namespace bpp; using namespace std; int main() { try { ifstream input("example.gff", ios::in); GffFeatureReader reader(input); while (reader.hasMoreFeature()) { BasicSequenceFeature feature = reader.nextFeature(); cout << "Found feature " << feature.getId() << " of type " << feature.getType() << ", starting at " << feature.getStart() << " and ending at " << feature.getEnd() << endl; } return 0; } catch (exception& ex) { cerr << ex.what() << endl; return 1; } } bpp-seq-omics-2.2.0/test/example.fastq000664 001750 001750 00000000400 12372454303 021325 0ustar00jdutheiljdutheil000000 000000 @EAS54_6_R1_2_1_413_324 CCCTTCTTGTCTTCAGCGTTTCTCC + ;;3;;;;;;;;;;;;7;;;;;;;88 @EAS54_6_R1_2_1_540_792 TTGGCAGGCCAAGGCCGATGGATCA + ;;;;;;;;;;;7;;;;;-;;;3;83 @EAS54_6_R1_2_1_443_348 GTTGCTTCTGGCGTGGGTGGGGGGG +EAS54_6_R1_2_1_443_348 ;;;;;;;;;;;9;7;;.7;393333 bpp-seq-omics-2.2.0/test/test_fastq.cpp000664 001750 001750 00000005243 12372454303 021525 0ustar00jdutheiljdutheil000000 000000 // // File: test_fastq.cpp // Author: Sylvain Gaillard // Created: 22/11/2011 11:29:16 // /* Copyright or © or Copr. Bio++ Development Team, (November 22, 2011) This software is a computer program whose purpose is to provide classes for numerical calculus. This file is part of the Bio++ project. This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info". As a counterpart to the access to the source code and rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty and the software's author, the holder of the economic rights, and the successive licensors have only limited liability. In this respect, the user's attention is drawn to the risks associated with loading, using, modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean that it is complicated to manipulate, and that also therefore means that it is reserved for developers and experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and, more generally, to use and operate it in the same conditions as regards security. The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms. */ #include #include #include #include #include #include using namespace bpp; int main () { try { std::string filename = "example.fastq"; std::ifstream input(filename.c_str(), std::ios::in); if (!input) { std::cerr << "Could not open " << filename << std::endl; return 1; } Fastq fq; const Alphabet* alpha = new DNA(); SequenceWithQuality seq("", "", alpha); while (fq.nextSequence(input, seq)) { std::cout << seq.getName() << " " << seq.size(); std::cout << " " << VectorTools::min(seq.getQualities()) - 33; std::cout << " " << VectorTools::max(seq.getQualities()) - 33; std::cout << std::endl; fq.repeatName(true); fq.writeSequence(std::cout, seq); fq.repeatName(false); } return 0; } catch (std::exception& ex) { std::cerr << ex.what() << std::endl; return 1; } } bpp-seq-omics-2.2.0/test/CMakeLists.txt000664 001750 001750 00000003241 12372454303 021400 0ustar00jdutheiljdutheil000000 000000 # CMake script for bpp-seq unit tests # Author: Julien Dutheil # Created: 30/07/2012 MACRO(TEST_FIND_LIBRARY OUTPUT_LIBS lib_name include_to_find) #start: FIND_PATH(${lib_name}_INCLUDE_DIR ${include_to_find}) SET(${lib_name}_NAMES ${lib_name} ${lib_name}.lib ${lib_name}.dll) FIND_LIBRARY(${lib_name}_LIBRARY NAMES ${${lib_name}_NAMES}) IF(${lib_name}_LIBRARY) MESSAGE("-- Library ${lib_name} found here:") MESSAGE(" includes: ${${lib_name}_INCLUDE_DIR}") MESSAGE(" dynamic libraries: ${${lib_name}_LIBRARY}") MESSAGE(WARNING "Library ${lib_name} is already installed in the system tree. Test will be built against it. This may lead to unexpected results. You may want to do 'make install' before 'make test', or remove the installed version.") ELSE() SET(${lib_name}_LIBRARY "-L../src -lbpp-seq-omics") SET(${lib_name}_INCLUDE_DIR "../src/") ENDIF() INCLUDE_DIRECTORIES(${${lib_name}_INCLUDE_DIR}) SET(${OUTPUT_LIBS} ${${OUTPUT_LIBS}} ${${lib_name}_LIBRARY}) ENDMACRO(TEST_FIND_LIBRARY) #Find the bpp-seq(-omics) library library: TEST_FIND_LIBRARY(LIBS bpp-seq-omics Bpp/Seq/Feature/SequenceFeature.h) ADD_EXECUTABLE(test_gff test_gff.cpp) TARGET_LINK_LIBRARIES(test_gff ${LIBS}) ADD_TEST(test_gff "test_gff") ADD_EXECUTABLE(test_fastq test_fastq.cpp) TARGET_LINK_LIBRARIES(test_fastq ${LIBS}) ADD_TEST(test_fastq "test_fastq") IF(UNIX) SET_PROPERTY(TEST test_gff test_fastq PROPERTY ENVIRONMENT "LD_LIBRARY_PATH=$ENV{LD_LIBRARY_PATH}:../src") ENDIF() IF(APPLE) SET_PROPERTY(TEST test_gff test_fastq PROPERTY ENVIRONMENT "DYLD_LIBRARY_PATH=$ENV{DYLD_LIBRARY_PATH}:../src") ENDIF() IF(WIN32) SET(ENV{PATH} "$ENV{PATH};..\\src") ENDIF() bpp-seq-omics-2.2.0/test/example.gff000664 001750 001750 00000003331 12372454303 020757 0ustar00jdutheiljdutheil000000 000000 ##gff-version 3 ##sequence-region ctg123 1 1497228 ctg123 . gene 1000 9000 . + . ID=gene00001;Name=EDEN ctg123 . TF_binding_site 1000 1012 . + . ID=tfbs00001;Parent=gene00001 ctg123 . mRNA 1050 9000 . + . ID=mRNA00001;Parent=gene00001;Name=EDEN.1 ctg123 . mRNA 1050 9000 . + . ID=mRNA00002;Parent=gene00001;Name=EDEN.2 ctg123 . mRNA 1300 9000 . + . ID=mRNA00003;Parent=gene00001;Name=EDEN.3 ctg123 . exon 1300 1500 . + . ID=exon00001;Parent=mRNA00003 ctg123 . exon 1050 1500 . + . ID=exon00002;Parent=mRNA00001,mRNA00002 ctg123 . exon 3000 3902 . + . ID=exon00003;Parent=mRNA00001,mRNA00003 ctg123 . exon 5000 5500 . + . ID=exon00004;Parent=mRNA00001,mRNA00002,mRNA00003 ctg123 . exon 7000 9000 . + . ID=exon00005;Parent=mRNA00001,mRNA00002,mRNA00003 ctg123 . CDS 1201 1500 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1 ctg123 . CDS 3000 3902 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1 ctg123 . CDS 5000 5500 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1 ctg123 . CDS 7000 7600 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1 ctg123 . CDS 1201 1500 . + 0 ID=cds00002;Parent=mRNA00002;Name=edenprotein.2 ctg123 . CDS 5000 5500 . + 0 ID=cds00002;Parent=mRNA00002;Name=edenprotein.2 ctg123 . CDS 7000 7600 . + 0 ID=cds00002;Parent=mRNA00002;Name=edenprotein.2 ctg123 . CDS 3301 3902 . + 0 ID=cds00003;Parent=mRNA00003;Name=edenprotein.3 ctg123 . CDS 5000 5500 . + 1 ID=cds00003;Parent=mRNA00003;Name=edenprotein.3 ctg123 . CDS 7000 7600 . + 1 ID=cds00003;Parent=mRNA00003;Name=edenprotein.3 ctg123 . CDS 3391 3902 . + 0 ID=cds00004;Parent=mRNA00003;Name=edenprotein.4 ctg123 . CDS 5000 5500 . + 1 ID=cds00004;Parent=mRNA00003;Name=edenprotein.4 ctg123 . CDS 7000 7600 . + 1 ID=cds00004;Parent=mRNA00003;Name=edenprotein.4